Part:BBa_K3558000
Small Heat Shock Protein 22E (sHSP22E)
Usage and Biology
Small heat shock proteins (sHSP) are ATP-independent molecular chaperones which associate with misfolded proteins to prevent further aggregation when the cell is under thermal stress. They are therefore classified as “holdases”. (1) Proteins are functional when they are soluble in their environments. However, thermal stress exposes the protein hydrophobic core to the outside, rendering them insoluble. sHSPs reverse this process by binding to the exposed core and prevent them from becoming insoluble. The sHSP/substrate complex then prevents further aggregation of proteins and facilitates the binding of ATP-dependent HSPs for protein refolding. (2) sHSPs are ubiquitous across organisms as they have a high binding capacity, making them a suitable candidate in reversing heat shock. In addition, sHSP genes are upregulated by 1000 folds when they are exposed to cellular stress and this consequently can increase the activity of ATP-dependent chaperones by 80%. (3)
It was hypothesised that transforming small heat shock proteins 22E and 22F from Chlamydomonas reinhardtii (C. reinhardtii) into Symbiodinium would increase the thermal threshold of the latter microorganism. C. reinhardtii is a green algae which is stable at 42oC, (4) well above the bleaching threshold of Great Barrier Reef. (5,6) These sHSPs target the chloroplast, hence protecting the photosystems from reactive oxygen species produced by thermal shock. (4) As a result, the expulsion of Symbiodinium sp. from the coral tissue will be prevented and the rate of bleaching will decrease.
Due to limited lab time resulting from COVID-19 restrictions, lab work focused on characterising these novel molecular chaperones through recombinant expression in a standard laboratory chassis. Plasmid assembly and cloning into competent strains allowed for protein expression and purification of small heat shock proteins 22E and 22F. Functional assays demonstrated their ability to successfully reduce protein aggregation in thermal stress conditions.
The design, test, build cycle was utilised at multiple levels during this process. Following project design, experimental goals to characterise HSP22E and HSP22F were defined. This informed plasmid design and subsequent ‘build’ phases in the form of DNA cloning and purification and ‘test’ phases with characterising assays. The cycle was applied in order to adapt protocols to lab challenges and optimise conditions purifications and assays. The conclusions drawn from lab work this year will go on to inform future work in Phase II of the project.
Plasmid Design and Cloning
Plasmid Design with HSP22E and HSP22F Inserts
DNA sequences for our genes of interest (HSP22E and HSP22F) were obtained from Genbank. Gene constructs for each were designed with the following features: Gibson forward and reverse overhangs - These were added onto both 5’ and 3’ ends of the gene sequences. The overhangs were complementary to the pET-19b plasmid backbone. Fwd: 5’ CGGCTGCTAACAAAGCCCGA 3’ Rev: 5’ CTTTAAGAAGGAGATATACC 3’ 6x His-tag and GSG linker - The His-tag consisted of six histidines, which later allowed for protein purification using an affinity column. The GSG linker allowed for protein folding without interference by the 6xHis-tag. 5’ GGCTCCGGCGGACATCATCATCATCACCATTAA 3’ As the HSP22 genes were obtained from eukaryotic C. reinhardtii, gene constructs were codon optimised for E. coli using the IDT Codon Optimisation Tool. DNA g-blocks were synthesised from Integrated DNA Technologies (IDT).
Constructs were designed to be inserted into the pET-19b plasmid backbone, a standard protein expression vector. It possesses the ampicillin resistance gene to allow for selection of successfully transformed colonies. It also utilises the T7 expression system, which compliments our chosen chassis E.coli BL21 DE3. The DE3 strains carry a copy of the phage T7 RNA polymerase gene which is controlled by a lac promoter. When isopropyl β- d-1-thiogalactopyranoside (IPTG) is added, the T7 RNA Polymerase is expressed and can bind to the plasmid T7 promoter and begin the transcription of the inserted gene.
Plasmid Assembly and Transformation
The two gene constructs were inserted into linearised pET-19b plasmid backbone using Gibson assembly to form two different plasmid products. Plasmids were transformed into E.coli BL-21 using the heat shock method. These were plated onto ampicillin agar plates, alongside two negative controls, and incubated overnight. HSP22E transformation plates were found to have 7 viable colonies, while HSP22F transformation plates were found to have 10 viable colonies. 5 viable colonies from each were selected, patch plates were taken and glycerol stocks were made.
Colony PCR was performed and PCR products were visualised via DNA gel electrophoresis to identify which colonies contained the desired plasmid. Successful Gibson assembly and transformation is indicated in colony 5 (C5) for HSP22E and colonies 2-5 (C2-5) for HSP22F, seen in the bands boxed in (colour) at around 850 bp. Colonies 1 for both HSP22E and HSP22F showed slightly higher bands boxed in (colour) at around 1000 bp. These were also investigated in further steps.
Plasmid Purification and Sequencing
HSP22E Colonies 1 and 5 (C1, C5) and HSP22F Colonies 1, 2 and 4 (C1, C2, C4) were selected to verify for successful Gibson and transformation. These colonies were grown up in larger cultures overnight. Plasmids were extracted and purified using the Qiagen QiaSpin Miniprep Kit. Samples were measured on the ThermoFisher NanoDrop Spectrophotometer to identify DNA concentration and purity.
The successful Gibson assembly and transformation was further confirmed with Sanger sequencing at the Ramaciotti Centre for Genomics (UNSW, Sydney). Both forward and reverse sequencing reactions were submitted. Sequencing results analysis using the alignment tool on Benchling indicated high sequencing homology for all colonies. Sequences were identical to the original gene construct for HSP22E C5 and HSP22F C2 and C4. HSP22E C1 and HSP22F C1 had a high level of mismatched bases compared to the original sequence and were omitted from future steps.
Discussion
The cloning process was successful and recombinant E. coli containing our designed plasmid were obtained. This was verified using PCR visualisation, NanoDrop photospectrometry and Sanger sequencing. A number of controls were used throughout this to ensure that only successful transformants were identified for future steps. When transforming the cells, two negative controls were also conducted. In these, water or just plasmid backbone were added to competent cells instead of the Gibson reaction. The water only negative control plate indicated 0 colonies, confirming that colonies on other plates weren’t due to contamination. Plasmid backbone only control plates grew 6 colonies, indicating that there were background circularised plasmid present. This is likely the explanation for the multiple bands at unexpected sizes seen in the DNA gel electrophoresis (C2-4 for HSP22E).
Additionally, when sequencing to confirm identity of the gene inserts, both a forward sequencing and reverse sequencing reaction was submitted for each colony. This ensured that sequencing errors would not affect results. This proved helpful when sequencing results for HSP22F Colony 2 (reverse primer) indicated the addition of a guanine base. However, this was not present in the forward sequencing reaction, and further inspection of the sequencing chromatogram confirmed that it was only a base calling error.
Expression and Purification
Expression of HSP22E and HSP22F
Overnight cultures for HSP22E C5, HSP22F C2 and HSP22F C4 were made. Samples were inoculated into fresh Luria broth and grown until OD600 reached 0.6. The culture was divided into 2 smaller cultures before IPTG was added to induce expression of the HSP22 proteins in the E. coli cultures and grown overnight at 20oC. Cells were harvested and frozen for future work.
A protein expression check was performed using the BugBuster cell lysis agent to separate soluble and insoluble protein fractions. SDS-PAGE was used to visualise the protein bands and compare non-induced samples from induced samples. This showed that most protein was soluble. Expression seemed to be successful for all cultures as a new, comparatively darker band can be seen in the soluble after inductions fractions at around 37 kDa. Though this is higher than our expected hand at 22 kDa, previous literature suggested that recombinant sHSPs may run at higher bands.
Protein Purification of HSP22E and HSP22F
To verify this, cell cultures were then lysed through sonication and the His-tagged HSP22E and HSP22F were purified using HisPur Ni-NTA resin in a gravity column. The purification was repeated three times, each with protocol optimisations to improve purity of the fractions obtained.
Purification fractions were visualised using SDS-PAGE. In the third attempt, HSP22E purification shows fractions with high concentration and greater purity in lanes 11, 12, 13 and 14. The HSP22F purification also shows high concentration of protein, but with greater background noise. The column used for this purification was the same as that of the highly contaminated HSP22E purification in attempt #2, indicating that it was a problem within the column filter causing contamination. Regardless, both purifications were deemed successful, with enough pure protein present for further assays. Fractions from 250 mM to 400 mM (lanes 11-14) were pooled to obtain a larger sample.
Discussion
During protein expression, the initial large 500mL culture was grown at 37oC on a large shaking incubator. However, post induction of IPTG there were no large shaking incubators were available to be set for 20oC, which is required for good expression overnight. Instead the 500mL culture was split into 2, 250 mL cultures which had their BugBuster expression checked separately to ensure both cultures showed good expression.
Purification protocols were optimised through multiple iterations. The first purification indicated high levels of contamination at most elution fractions. Given this, in the second purification, the lysate incubation steps and wash steps were conducted using centrifugation rather than gravity columns. This provided a greater surface area and incubation time for HSP22 proteins to bind to the resin. The elution steps were conducted in the gravity column as normal. Additionally, elution buffer gradients were taken at a lower range from 50 mM - 150 mM to knock off contaminating proteins that bind to the column at a lower affinity. The final elution fraction was 500 mM to elute the tightly binding HSP22. While this resulted in a purer 500 mM fraction, the band was fainter and not as much protein was eluted. Subsequently, the third purification used a Binding buffer with a higher concentration of 20 mM imidazole. As it had already been determined that HSP22E and HSP22F bind very tightly to the column, the His-tagged proteins would still be able to bind while contaminants will be more likely to be washed off. Elution gradients were also increased to 50 mM - 500 mM imidazole. These higher concentrations allowed for more of the tightly binding HSP22E and HSP22F to be knocked off, resulting in a purer purification.
Additionally, the HSP22E purification attempt #2 showed very high levels of background protein in all elution fractions. Though this was initially thought to be due to the concentration of imidazole in the elution buffer, the next attempt showed a similar result for HSP22F. It was determined that this was likely occurring due to contamination of the filter within the gravity column itself.
Characterisation and Assay
Protein Concentration Assay
In order to exchange the elution buffer to a more suitable buffer for subsequent assays, snakeskin dialysis was attempted. However, the small heat shock protein samples precipitated out in all attempts. Therefore, due to time constraints and limited lab access we performed our protein concentration Bradford assay using the proteins in the pooled 325 mM imidazole elution buffer as the samples were able to remain stable within it. All subsequent assays were designed to account for and normalise background imidazole within the sample. The Bradford assay was used to determine the concentrations of our proteins for our characterisation gels and chaperone activity assays.
Bradford assay uses Bradford reagent to visualise protein concentration, with measurements conducted on the SPECTROstar Nano absorbance reader (BMG Labtech) at 450nm and 590nm. The first attempt for the Bradford assay did not work well as the amount of protein was overestimated due to the high amounts of imidazole in the buffer which could react with the Bradford reagent. The assay was re-designed to account for background levels of imidazole. It was performed using PBS to dilute the samples and as a blank. A standard curve was constructed using bovine serum albumin (BSA) of known concentration. The amount of imidazole was normalised by measuring the absorbance of the same volume of 325 mM imidazole elution buffer and subtracting the absorbance from the HSP22E and HSP22F samples. Using the standard curve, the concentrations were determined to be 1.23 μM HSP22E and 2 μM HSP22F.
Characterisation of Complex Formation for HSP22E and HSP22F
Earlier purification gels indicated two dark bands at around 37 kDa and 70 kDa. It was considered likely that these were our purified proteins self-dimerising. To confirm this, pooled fractions of HSP22E and HSP22F were visualised on a SDS-PAGE both with and without DTT. DTT was used to reduce cysteines and prevent dimer formation through disulfide interactions. HSP22E and HSP22F samples were also incubated together in one fraction and visualised on the same gels to further characterise their interactions. Samples with DTT showed darker bands at 37kDa, indicating monomeric conformation. Samples without DTT showed increasingly darker bands at around 70, 140, 200 kDa and higher. This indicated higher order complex formation. Additional visualisation of samples in their Native state on a Native gel indicated similar formation of many higher order complexes. This finding was confirmed with structural modelling.
Chaperone Activity Assay
Sequence and Features
- 10INCOMPATIBLE WITH RFC[10]Illegal PstI site found at 455
Illegal PstI site found at 461 - 12INCOMPATIBLE WITH RFC[12]Illegal PstI site found at 455
Illegal PstI site found at 461 - 21COMPATIBLE WITH RFC[21]
- 23INCOMPATIBLE WITH RFC[23]Illegal PstI site found at 455
Illegal PstI site found at 461 - 25INCOMPATIBLE WITH RFC[25]Illegal PstI site found at 455
Illegal PstI site found at 461 - 1000COMPATIBLE WITH RFC[1000]
| None |