Collections/Immune Regulation

Revision as of 19:11, 24 October 2020 by Soumo sarkar (Talk | contribs)

The immune system requires a homeostatic balance of the components involved. It is part of the complex biological response of the body to several substances such as pathogen, antigens, allergens, etc. It is a protective mechanism that is triggered by several signals (oxidative stress, signal peptides, receptors, etc) and is regulated by the balance of pro and anti-inflammatory substances. In order to help future teams to engineer safe, effective, and required responses, we have curated the Immune regulation collection with the parts that have been designed and used by other previous teams. The collection is divided into sense and control, pro and anti-inflammatory substances, antibodies, receptors, and composite control mechanism devices to enable easy access during design. In case your iGEM team has designed a new part that involves any of these aspects, please do add on to the collection.


Sense & Control

Accidental release of inflammatory molecules can prove to be dangerous to the human body. These are parts that activate certain mechanisms like inflammatory responses only under particular conditions. eg: presence of certain pro-inflammatory compounds/molecules


More...
NameDescriptionTypeCreated bylengthusesseq
BBa_K1799015pYeaRRegulatoryWill Shindel100  . . . aatgcaaattatcaggcgtaccctgaaacg
BBa_K203111Constitutive promoter; 2 REURegulatoryLars Velten, Simon Haas, Hannah Meyer, Anne Rademacher, Hannah Uckelmann and Corinna Hiller426  . . . gccgggatttgggtcgcggttcttgtttgt
BBa_K256004NorRCodingiGEM09_NTU-Singapore15156 . . . ctggcgaaacgtctgggattgaaggattaa
BBa_K2976009NF-κB induced promoterRegulatoryJiatong Chen1092 . . . gtacggtgggaggtctatataagcagagct
BBa_K3244013NFAT-Response EllementRegulatoryMohammad Tarek Mansour1171 . . . ttcatacagaaggcgttcaagcttgtcgac
BBa_K3244014IL-2 PromoterRegulatoryMohammad Tarek Mansour1141 . . . atcactactcacagtaacctcaactcctgc
BBa_K554000SoxS promoterRegulatoryUNICAMP_EMSE Brazil team627 . . . atactccccaacagatgaattaacgaactg
BBa_K554003SoxRCodingUNICAMP EMSE Brazil team4837 . . . cgcttgctggaagatgaacaaaactaataa

Inflammatory

This set includes compounds and cytokines which are pro-inflammatory and Anti inflammatory (or both).


More...
NameDescriptionTypeCreated bylengthusesseq
BBa_K1228004A fragment of loctoferrin CodingZhang SW75  . . . ccgagcattacctgcgtgcgtcgcgccttt
BBa_K1319003human galectin-3, codon optimized for E. coliCodingMichael Osthege753  . . . acctctgccagctacaccatgatctaataa
BBa_K1611000IFNgammaCodingFrederic Ros471  . . . aggaagcggaaaaggagtcgctgctgataa
BBa_K1728004IL8 partial sequenceRNAYung-Li Chen, Zih-Yu Liu, Cheng-Hsiung Hsu1021 . . . tagggttgccagatgcaatacaagattcct
BBa_K1728005IL1β partial sequenceRNAYung-Li Chen, Zih-Yu Liu, Cheng-Hsiung Hsu891 . . . ttcttcgacacatgggataacgaggcttat
BBa_K1929300Interleukin-2 (IL-2) with designed RBSCodingMaxwell Ng6461 . . . ttctgcgtttatactcgagctgcgtttata
BBa_K223053hIL-6 Generator (Freiburg-compatible)GeneratorAnusuya Ramasubramanian620  . . . accggttaatactagtagcggccgctgcag
BBa_K2520045Bee venom PLA epitope 1Protein_DomainDana Kadosh361 . . . cactacaccgtggacaagtccaagcccaag
BBa_K2653015TNF-αCodingJiaxin Ma734  . . . gaccaaggtggaaatcaaacgggcggccgc
BBa_K2817004Myrosinase (horseradish)CodingZhaoyu Liu1533  . . . aaatggttctctaaattcctggctaaataa
BBa_K2876014IL1BCodingEleanor Glockner807  . . . accgattttaccatgcagtttgtgagcagc
BBa_K2913019TNF-αCodingYuhan Liu, Yannan Wang1383  . . . acgaaaggctcagtcgaaagactgggcctt
BBa_K2924028β-caseinCodingMelanie Sbielut, Andreas Nakielski702  . . . ggatcccaccaccaccaccaccactaataa
BBa_K2924041Lactoferrin CodingMelanie Sbielut 10551 . . . tatctgacgacactgaaaaatttgcgtgaa
BBa_K2957000IL-8 (CXCL8) CodingCloning Team (Melody, Margaret, Krissy, Ethan)3144 . . . tcttgaaaagggccgaaaactcataagctt
BBa_K2957094C5aCodingYe Cheng Zheng3066  . . . gcagaagatatcttcctgaatggatgctaa
BBa_K2986014Interleukin 10Codingzheng shuxin5341 . . . gaagcctacatgacaatgaagatacgaaac
BBa_K2986015Interleukin 8DNAzheng shuxin2971 . . . gagaagtttttgaagagggctgagaactca
BBa_K3009001FPR2 receptorSignallingCarolin Ruckes10592 . . . gctgagacagaactccaagcgatgatcgat
BBa_K3078005LL-37CodingZiang Guo1172 . . . cgtaatctggttccgcgtaccgaaagctaa
BBa_K3132017human interleukine 15CodingQiliang Yang373  . . . cacatcgtccagatgttcatcaataccagc
BBa_K3234000Human interleukin 2CodingYuxin Huang399  . . . ttcgcccagagcatcatcagcacgctgacc
BBa_K3244015IL-18CodingMohammad Tarek Mansour5791 . . . agcatcatgttcaccgtgcagaacgaggac
BBa_K554004IL10CodingUNICAMP EMSE Brazil team5041 . . . tacatgacgatgaaaatccgtaactaataa


Receptors

This set contains some membrane receptors.


More...
NameDescriptionTypeCreated bylengthusesseq
BBa_K1391002CD79ACodingAlexa Garcia684  . . . ggagatgtccagctggagaagccgtagtag
BBa_K1391003CD79BCodingAlexa Garcia693  . . . gtaggtgagcacccaggccaggagtagtag
BBa_K1993001CCR7CodingSu Xiaojun1137  . . . gccgagaccaccaccaccttctccccatag
BBa_K1993002CXCR1CodingZhou Longyuan 1053  . . . tcgtctgtcaatgtctcttccaacctctga
BBa_K1993003CXCR4CodingSu Xiaojun10712 . . . tctgagtcttcaagttttcactccagctaa
BBa_K1993004CCR5CodingSu Xiaojun1059  . . . ggggagcaggaaatatctgtgggcttgtga
BBa_K1993012CCR2CodingSu Xiaojun1125  . . . gccagtcttcaggacaaagaaggagcctag
BBa_K1993013CXCR5CodingSu Xiaojun11191 . . . gagaatgccacctctctcaccacgttctag
BBa_K2549001suface-expressed CD19CodingRongrong Du10831 . . . ttgatcatgctttggcagaagaaacctaga
BBa_K2583000HRH4_CDSCodingLiuJie11936 . . . atcttcttaaaagctttggacttcttcgcc
BBa_K2976000Toll-like receptor 1CodingJiatong Chen54  . . . tgcggcgacgtggaggagaaccccggcccc
BBa_K2976001Toll-like receptor 1CodingJiatong Chen23611 . . . attaagctgacagagcaagcaaagaaatga
BBa_K2976002Toll-like receptor 2 CodingJiatong Chen23581 . . . aatctgagagctgcgataaagtcctgatga
BBa_K2976003Cluster of differentiation 14 (CD14)CodingJiatong Chen11281 . . . ctgctccaaggggcccggggctttgcctaa
BBa_K321004intracellular chain of KIR3DL1Protein_DomainHannah Yan2401 . . . aagcccagatccaaagttgtctcctgccca


Antibodies

Antibodies are proteins used by the immune system to neutralise pathogens such as viruses and microorganisms. This set contains a few antibodies previously used.


More...
NameDescriptionTypeCreated bylengthusesseq
BBa_K1071007Hep B Antibody light chainCodingTeam Marburg 2013711  . . . acaaagagcttcaaccgtggagagtgttag
BBa_K1071008Hep B Antibody heavy chainCodingTeam Marburg 201314043 . . . aagagcctctccctgtctccgggtaaatga
BBa_K1391000Gantenerumab Variable Human Ig-M Heavy ChainCodingAlexa Garcia1860  . . . accgtgaccctctttaaggtgaagtagtag
BBa_K1391001Gantenerumab Variable Human Ig-M Light ChainCodingAlexa Garcia720  . . . aagagctttaacaggggggagtgctagtag
BBa_K1694003Single-chain variable fragment (Anti-VEGF) CodingCHIH-HSUAN HSU7472 . . . cagggcaccctggttaccgtgagcagttaa
BBa_K1694004Single-chain variable fragment (Anti-EGFR)CodingCHIH-HSUAN HSU7351 . . . cagggcaccctggtgacagtgagtgcataa
BBa_K1694005Single-chain variable fragment (Anti-HER2)CodingCHIH-HSUAN HSU5822 . . . acctctgaagattctgcggtctattactgt
BBa_K1933004constitutive promoter and RBSRegulatoryTomoki Uchino 606 . . . ctagcactagagaaagaggagaaatactag
BBa_K2247006Single-chain variable fragment 1 of anti-Aflatoxin B1 antibody (antiAFB1-ScFv1)CodingJianing Han7321 . . . ggggggaccaagctggagctgaaacggtag
BBa_K2520001Single Chain Fragment Variable (scFv) of rat anti-murine IgM antibodyCodingNoa Eden, Dana Kadosh699  . . . tggggccaaggagtcatggtcacagtctcc
BBa_K2520043Celiac epitope 1 Protein_DomainDana Kadosh271cccttcccccagccccagctgccctac
BBa_K2520044Celiac epitope 3Protein_DomainDana Kadosh271ccctacccccagccccagctgccctac
BBa_K2622004scFv_antiVGYCodingAuksė Gaiauskaitė733  . . . gcagggcacatccgtgacggtatcgtcagc
BBa_K2876007anti-aflatoxinB1 ScFv1CodingEleanor Glockner732  . . . ggggggaccaagctggagctgaaacggtag
BBa_K2876011IL-1 Beta scFv2CodingEleanor Glockner720  . . . ggccagggcaccctggtgaccgtgagcagc
BBa_K2876015anti-IL1B scFv1CodingEleanor Glockner772  . . . cgtgagcagctaaggatcctctacgccgga
BBa_K2946000scFv (Single-Chain Variable Fragment)Protein_Domaineden asraf8101 . . . ggccaaggcacatccgtaaccgtaagctca
BBa_K3064009mmuIgG-FcCodingJie Cai5282 . . . ctgacctgcatgataacagacttcttccct
BBa_K3090001single chain variable fragment (scFv(P5))DNAJungwoo Choe7171 . . . ggtggtggaactaaattggagatcaagcgc
BBa_K3090002single chain variable fragment (scFv(P5)) with cppDNAJungwoo Choe768  . . . ggtggtggaactaaattggagatcaagcgc
BBa_K3117039kappa light chainProtein_DomainLena Schorr3212 . . . gtaaccaaatccttcaaccgtggtgaatgc
BBa_K3117040constant region 1 (CH1) of an antibodyProtein_DomainLena Schorr3242 . . . gagccgaaatcttgcgataaaactcatact
BBa_K3132005anti-HER2 scFVCodingQiliang Yang697  . . . ggaggaggaacaaagctgacggttcttgga
BBa_K3346000Siltuximab Heavy Variable Chain for IgGCodingEmily Laskey328-1 . . . gcctgtggggctattatgcgctggattatt
BBa_T2018V5 epitope tag tail domain (GKPIPNPLLGLDST)Protein_DomainReshma Shetty48  . . . ccgctcctgggcctcgattccacgtaataa
BBa_T2019V5 epitope tag head domain (GKPIPNPLLGLDST)Protein_DomainReshma Shetty48  . . . ccgaacccgctcctgggcctcgattccacg
BBa_T2020V5 epitope tag special internal domain (GKPIPNPLLGLDST)Protein_DomainReshma Shetty42  . . . ccgaacccgctcctgggcctcgattccacg


Others

This set contains other miscellaneous molecules whose functions are related to the immune system.


More...
NameDescriptionTypeCreated bylengthusesseq
BBa_K1686045crdA gene with codon optimisation for E. coliCodingJean Descarpentrie1458  . . . caaacgaagatttcccgtacgcagagctaa
BBa_K1686047crdC gene with codon optimisation for E. coli CodingJean Descarpentrie1266  . . . ggtgtatcatcaatgcatgaagctgagtaa
BBa_K2226003COX-2 geneDNAAn-Chi Tsai7561 . . . aaatttttggaatgattaaatgaacaataa
BBa_K2309021LL-37 for Lactococcus lactis NZ9000 (codon optimized)CodingZixin Rong1204 . . . aaccttgttccacgtactgaatcataataa
BBa_K2539250ALDH2*2 Basic PartCodingCatherine Chang15542 . . . acagtcaaagtgcctcagaagaactcataa
BBa_K2885000Protien G (ProG)CodingSungho Ko5552 . . . gacgcgactaaaacttttaccgttaccgaa
BBa_K2976006Anti-PD-L1 peptideCodingJiatong Chen721 . . . gtgcgccgcatcgaggacatgatgaaccag
BBa_K380010Immunoglobulin G protease (IdeS)CodingNina Schiller930  . . . acagggcaagatagttggaatcagaccaat