Coding

Part:BBa_K142040

Designed by: Julius Rabl   Group: iGEM08_ETH_Zurich   (2008-10-16)
Revision as of 21:25, 16 October 2008 by Jrabl (Talk | contribs)

ribosome modulation factor (RMF)

Short description: RMF is a 6.5kDa protein from E. coli, which upon expression rapidly terminates protein translation by binding to the ribosome active center. RMF can be removed and degraded by the cell, making its action reversible. Expression of RMF can be utilized to stop protein production in the cell if cell growth or the transcriptional responses of the cell are actively interfering with any planned genetic circuit. It enables the genetic engineer to turn the cell from an actively responding biological network into a mere test tube for any chosen duration of time. It might be of interest for certain applications that the amount of RMF molecules in the cell is unlikely to exceed the number of ribosomes.

Detailed description: Bacteria like E. coli terminate protein synthesis rapidly upon reaching the stationary phase of growth. Termination of translation is associated with dimerization of bacterial ribosomes; dimers (sedimentation velocity 100S as compared to 70S for standard monomeric ribosome) can be separated from monomers by sucrose gradient ultracentrifugation in low salt buffer, but dissociate during negative staining for transmission electron microscopy unless considerable amounts of crosslinking agents are used. Analysis of stationary phase ribosomes in E. coli has shown that several factors bind to the ribosome upon dimerization including RMF (1) and the hibernation promoting factor (2). RMF is expressed under a growth-phase dependent promotor (3) and sufficient to induce ribosome dimerization and termination of translation (4). Consequently, cells lacking RMF are unable to form dimers and have a markedly reduced survival rate in the stationary phase (5, 6). The structure of RMF has been determined by nuclear magnetic resonance (7) and biochemical crosslinking experiments have identified the binding site on the ribosome close to the peptidyl transferase center (8). Overexpression of RMF rapidly terminates protein production and growth of the cell; however unlike toxic proteins it does not kill the cell. Since RMF is a native constituent of the ribosome hibernation pathway it is assumed to be the least harmful way for turning off cell growth and protein production rapidly if cell viability is important for subsequent experiments.



References:

(1) Wada, A., Yamazaki, Y., Fujita, N., and Ishihama, A. (1990) Structure and probable genetic location of a "ribosome modulation factor" associated with 100S ribosomes in stationary-phase Escherichia coli cells. Proc Natl Acad Sci U S A 87, 2657-61.

(2) Ueta, M., Ohniwa, R. L., Yoshida, H., Maki, Y., Wada, C., and Wada, A. (2008) Role of HPF (hibernation promoting factor) in translational activity in Escherichia coli. J Biochem 143, 425-33.

(3) Yamagishi, M., Matsushima, H., Wada, A., Sakagami, M., Fujita, N., and Ishihama, A. (1993) Regulation of the Escherichia coli rmf gene encoding the ribosome modulation factor: growth phase- and growth rate-dependent control. Embo J 12, 625-30.

(4) Wada, A., Igarashi, K., Yoshimura, S., Aimoto, S., and Ishihama, A. (1995) Ribosome modulation factor: stationary growth phase-specific inhibitor of ribosome functions from Escherichia coli. Biochem Biophys Res Commun 214, 410-7.

(5) El-Sharoud, W. M., and Niven, G. W. (2007) The influence of ribosome modulation factor on the survival of stationary-phase Escherichia coli during acid stress. Microbiology 153, 247-53.

(6) Yoshida, H., Maki, Y., Kato, H., Fujisawa, H., Izutsu, K., Wada, C., and Wada, A. (2002) The ribosome modulation factor (RMF) binding site on the 100S ribosome of Escherichia coli. J Biochem 132, 983-9.

(7) Tang, Y., Rossi, P., Swapna, G., Wang, H., Jiang, M., Cunningham, K., Owens, L., Ma, L., Xiao, R., Liu, J., Baran, M.C., Acton, T.B., Rost, B., Montelione, G.T. . (2007) Solution NMR Structure of Ribosome Modulation Factor VP1593 from Vibrio parahaemolyticus. Unpublished work.

(8) Yoshida, H., Yamamoto, H., Uchiumi, T., and Wada, A. (2004) RMF inactivates ribosomes by covering the peptidyl transferase centre and entrance of peptide exit tunnel. Genes Cells 9, 271-8.


Sequence and Features


BBa_K142040 SequenceAndFeatures


ATGAAGAGACAAAAACGAGATCGCCTGGAACGGGCACATCAACGTGGTTATCAGGCCGGCATCGCCGGAC GCTCAAAAGAAATGTGTCCCTATCAGACGCTGAATCAAAGGTCACAATGGCTGGGAGGCTGGCGAGAAGC CATGGCGGACAGGGTAGTAATGGCCTAATAA 


Not understood


[edit]
Categories
Parameters
None