Ribosome Binding Sites/Prokaryotic/Constitutive/Community Collection
Description
The Weiss RBS family are suitable for general protein expression in E. coli or other prokaryotes. The family is known to cover a range of translation initiation rates so by testing a few family members it should be possible to find a translation initiation rate that suits your application. This set of RBS were used and compared against one another by [http://weisswebserver.ee.princeton.edu/users/rweiss/ Ron Weiss]. BBa_B0030 is based on the CI RBS of bacteriophage λ. The remaining members of the set were first described by Gardner et alGardner. Further information about the RBS parts can be obtained from Prof. Weiss' [http://www.princeton.edu/~rweiss/papers/rweiss-phd-thesis.pdf PhD thesis].
Obtaining Weiss RBS parts
Via de novo synthesis: Since the RBS parts are short sequences, they can be easily and cheaply ordered as two single-stranded complementary oligos and annealed. See here for a tutorial on how to construct short parts via oligo annealing.
Via the Registry distribution: The RBS parts are included in the Registry distribution. They are carried on pSB1A2.
Characterization of the Weiss RBS family
The data quoted in the table below was measured by Jason Kelly and Robbie Bryant during the summer of 2004 using a fluorescent reporter. Further data (although less quantitative) can be found in the doctoral thesis of [http://www.princeton.edu/~rweiss/papers/rweiss-phd-thesis.pdf Ron Weiss] (p79-80) and the supplementary methods of Gardner et alGardner. Note that the rank order of strengths as measured by Weiss and Kelly & Bryant differ from those reported by Gardner et al. This discrepancy is likely due to changes in nucleotide sequence between the Ribosome Binding Site and the start codon due to the cloning strategies used by the different groups. As is typical for RBS, translation initiation rate can be highly dependent on upstream and downstream sequence for reasons such as RBS occlusion due to mRNA secondary structure or changes in mRNA stability.
Weiss RBS family members
| Identifier | Sequencea | Strength |
|---|---|---|
| BBa_B0030 | TCTAGAGATTAAAGAGGAGAAATACTAGATG | 1 |
| BBa_B0031 | TCTAGAGTCACACAGGAAACCTACTAGATG | 0.12 |
| BBa_B0032 | TCTAGAGTCACACAGGAAAGTACTAGATG | 0.5 |
| BBa_B0033 | TCTAGAGTCACACAGGACTACTAGATG | 0.012 |
aThe sequence of individual RBS are shown in black and red. The grey nucleotides show the bracketing sequence that results from assembling the RBS with an upstream part and a downstream coding sequence. The start codon of the downstream coding sequence is shown in green. See the "Obtaining Anderson RBS parts" section above for a description of how the physical DNA sequence of the Anderson RBS parts in the Registry differs slightly from the BioBrick® standard.
References
<biblio>
- Gardner pmid=10659857
</biblio>