Collections/Cell-Free TX-TL
Next vivo
Our part collection will contain all the major biomolecules required for a cell-free transcription-translation system providing them in an easy to express and purify way that anyone can easily produce for their experimental purposes. These biomolecules include:
- 38 Transcription and Translation (TX-TL) protein genes codon optimized for E. coli expression
- 20 Next vivo MS2-tagged tRNA isolation genes
- 2 MS2-tagged ribosomal rRNA genes for isolation of functional ribosomes from the cell lysate
TX-TL Proteins: The initial focus for this collection was submitting all 38 TX-TL protein genes, codon optimized, hexahistidine tagged, and under the control of a T7 promoter system for controlled expression. We have submitted and characterized 9 of these parts to the registry in pSB1C3, characterized expression of 17 parts, and are working toward completing the remaining parts following the competition.
tRNA: The tRNA component of the Next vivo system was another of our focuses for this years project. Currently, no simple protocol exists for efficient and specific isolation of tRNA from the cell. We are happy to announce that we were able to develop a system that allows for the purification of specific, fully modified tRNA from cell lysate. The first tRNA in our part collection is that of tRNAPhe. With the success of our purification strategy, we plan to synthesize the remaining tRNA in our expression construct for submission into this collection.
Ribosomes: Currently we plan to BioBrick both the 23S and 16S E. coli ribosomal rRNA genes with the MS2 hairpin added into either sequence at a region that places it externally on the 3D ribosome structure. This design has previously been used before by another research lab to purify whole ribosomes using the MS2 binding protein tagged with a hexahistidine tag.
MS2BP: The MS2 binding protein is a central component to our tRNA and ribosome purification strategies. It was previously submitted by the 2016 Lethbridge iGEM team and we feel it would be a great addition to our Next vivo Part Collection.
Validation: Finally, we have also included our measurement control construct for the complete TX-TL system. This part expresses a RNA Spinach tagged EYFP mRNA and EYFP protein, that in the addition of DFHBI produces both green and yellow fluorescence indicating transcription and translation respectively.
| Name | Description | Type | Created by | length | uses | seq |
|---|---|---|---|---|---|---|
| BBa_K2109108 | MS2 6XHis (V29I/d1FG) | Composite | Andy Hudson | 640 | . . . caccttcgggtgggcctttctgcgtttata | |
| BBa_K2443000 | AlaRS optimized for expression in E. coli | Composite | Lethbridge iGEM 2017 | 2862 | . . . caccttcgggtgggcctttctgcgtttata | |
| BBa_K2443001 | ArgRS optimized for expression in E. coli | Composite | Lethbridge iGEM 2017 | 1965 | . . . caccttcgggtgggcctttctgcgtttata | |
| BBa_K2443002 | AsnRS optimized for expression in E. coli | Composite | Lethbridge iGEM 2017 | 1632 | . . . caccttcgggtgggcctttctgcgtttata | |
| BBa_K2443003 | AspRS optimized for expression in E. coli | Composite | Lethbridge iGEM 2017 | 2004 | . . . caccttcgggtgggcctttctgcgtttata | |
| BBa_K2443004 | CysRS optimized for expression in E. coli | Composite | Lethbridge iGEM 2017 | 1617 | . . . caccttcgggtgggcctttctgcgtttata | |
| BBa_K2443005 | GlnRS optimized for expression in E. coli | Composite | Lethbridge iGEM 2017 | 1899 | . . . caccttcgggtgggcctttctgcgtttata | |
| BBa_K2443006 | GluRS optimized for expression in E. coli | Composite | Lethbridge iGEM 2017 | 1650 | . . . caccttcgggtgggcctttctgcgtttata | |
| BBa_K2443007 | GlyRS Alpha subunit optimized for expression in E. coli | Composite | Lethbridge iGEM 2017 | 1143 | . . . caccttcgggtgggcctttctgcgtttata | |
| BBa_K2443008 | GlyRS Beta subunit optimized for expression in E. coli | Composite | Lethbridge iGEM 2017 | 2301 | . . . caccttcgggtgggcctttctgcgtttata | |
| BBa_K2443009 | HisRS optimized for expression in E. coli | Composite | Lethbridge iGEM 2017 | 1506 | . . . caccttcgggtgggcctttctgcgtttata | |
| BBa_K2443010 | IleRS optimized for expression in E. coli | Composite | Lethbridge iGEM 2017 | 3048 | . . . caccttcgggtgggcctttctgcgtttata | |
| BBa_K2443011 | LeuRS optimized for expression in E. coli | Composite | Lethbridge iGEM 2017 | 2814 | . . . caccttcgggtgggcctttctgcgtttata | |
| BBa_K2443012 | LysRS optimized for expression in E. coli | Composite | Lethbridge iGEM 2017 | 1750 | . . . caccttcgggtgggcctttctgcgtttata | |
| BBa_K2443013 | MetRS optimized for expression in E. coli | Composite | Lethbridge iGEM 2017 | 2265 | . . . caccttcgggtgggcctttctgcgtttata | |
| BBa_K2443014 | PheRS Alpha subunit optimized for expression in E. coli | Composite | Lethbridge iGEM 2017 | 1215 | . . . caccttcgggtgggcctttctgcgtttata | |
| BBa_K2443015 | PheRS Beta subunit optimized for expression in E. coli | Composite | Lethbridge iGEM 2017 | 2619 | . . . caccttcgggtgggcctttctgcgtttata | |
| BBa_K2443016 | ProRS optimized for expression in E. coli | Composite | Lethbridge iGEM 2017 | 1950 | . . . caccttcgggtgggcctttctgcgtttata | |
| BBa_K2443017 | SerRS optimized for expression in E. coli | Composite | Lethbridge iGEM 2017 | 1524 | . . . caccttcgggtgggcctttctgcgtttata | |
| BBa_K2443018 | ThrRS optimized for expression in E. coli | Composite | Lethbridge iGEM 2017 | 2160 | . . . caccttcgggtgggcctttctgcgtttata | |
| BBa_K2443019 | TrpRS optimized for expression in E. coli | Composite | Lethbridge iGEM 2017 | 1236 | . . . caccttcgggtgggcctttctgcgtttata | |
| BBa_K2443020 | TyrRS optimized for expression in E. coli | Composite | Lethbridge iGEM 2017 | 1506 | . . . caccttcgggtgggcctttctgcgtttata | |
| BBa_K2443021 | ValRS optimized for expression in E. coli | Composite | Lethbridge iGEM 2017 | 3087 | . . . caccttcgggtgggcctttctgcgtttata | |
| BBa_K2443022 | MTF optimized for expression in E. coli | Composite | Lethbridge iGEM 2017 | 1179 | . . . caccttcgggtgggcctttctgcgtttata | |
| BBa_K2443023 | IF1 optimized for expression in E. coli | Composite | Lethbridge iGEM 2017 | 456 | . . . caccttcgggtgggcctttctgcgtttata | |
| BBa_K2443024 | IF2 optimized for expression in E. coli | Composite | Lethbridge iGEM 2017 | 2904 | . . . caccttcgggtgggcctttctgcgtttata | |
| BBa_K2443025 | IF3 optimized for expression in E. coli | Composite | Lethbridge iGEM 2017 | 774 | . . . caccttcgggtgggcctttctgcgtttata | |
| BBa_K2443026 | EF-G optimized for expression in E. coli | Composite | Lethbridge iGEM 2017 | 2346 | . . . caccttcgggtgggcctttctgcgtttata | |
| BBa_K2443027 | EF-Tu optimized for expression in E. coli | Composite | Lethbridge iGEM 2017 | 1419 | . . . caccttcgggtgggcctttctgcgtttata | |
| BBa_K2443028 | EF-Ts optimized for expression in E. coli | Composite | Lethbridge iGEM 2017 | 1083 | . . . caccttcgggtgggcctttctgcgtttata | |
| BBa_K2443029 | RF1 optimized for expression in E. coli | Composite | Lethbridge iGEM 2017 | 1314 | . . . caccttcgggtgggcctttctgcgtttata | |
| BBa_K2443030 | RF2 optimized for expression in E. coli | Composite | Lethbridge iGEM 2017 | 1329 | . . . caccttcgggtgggcctttctgcgtttata | |
| BBa_K2443031 | RF3 optimized for expression in E. coli | Composite | Lethbridge iGEM 2017 | 1821 | . . . caccttcgggtgggcctttctgcgtttata | |
| BBa_K2443032 | RRF optimized for expression in E. coli | Composite | Lethbridge iGEM 2017 | 789 | . . . caccttcgggtgggcctttctgcgtttata | |
| BBa_K2443033 | MK optimized for expression in E. coli | Composite | Lethbridge iGEM 2017 | 879 | . . . caccttcgggtgggcctttctgcgtttata | |
| BBa_K2443034 | CK optimized for expression in E. coli | Composite | Lethbridge iGEM 2017 | 1377 | . . . caccttcgggtgggcctttctgcgtttata | |
| BBa_K2443035 | NDK optimized for expression in E. coli | Composite | Lethbridge iGEM 2017 | 717 | . . . caccttcgggtgggcctttctgcgtttata | |
| BBa_K2443036 | PPiase optimized for expression in E. coli | Composite | Lethbridge iGEM 2017 | 822 | . . . caccttcgggtgggcctttctgcgtttata | |
| BBa_K2443037 | T7 RNA Polymerase optimized for expression in E. coli | Composite | Lethbridge iGEM 2017 | 2886 | . . . caccttcgggtgggcctttctgcgtttata | |
| BBa_K2443038 | tRNAPhe-MS2 | Composite | Lethbridge iGEM 2017 | 300 | . . . caccttcgggtgggcctttctgcgtttata | |
| BBa_K2443039 | EYFP-Spinach transcription and translation (TX-TL) measurement device | Measurement | Lethbridge iGEM 2017 | 1063 | . . . caccttcgggtgggcctttctgcgtttata | |
| BBa_K2722000 | Exonuclease V, Subunit RecC | Coding | Enik Baligcs | 3369 | . . . ttaccgctgtttcgctttaatcagtcatga | |
| BBa_K2722001 | Exonuclease V, Subunit RecD | Coding | Enik Baligcs | 1827 | . . . ctggcggcgttgtttagttcgcgggaataa | |
| BBa_K2722002 | 6 times Chi recombination hotspot to inhibit Exonuclease V (RecBCD) activity | DNA | Enik Baligcs | 92 | . . . gccactgctggtggccactgctggtggcca |
- To add to this list, please use the category //collections/cell-free_tx-tl