Part:BBa_K1926002
A cyclic promoter of Ki-67 from human genome
This part is a cyclic promoter of Ki67 from human genome. It can lead to transcription of the downstream DNA sequence once in every G1 phase[1].
Sequence and Features
- 10COMPATIBLE WITH RFC[10]
- 12INCOMPATIBLE WITH RFC[12]Illegal NotI site found at 382
Illegal NotI site found at 497 - 21INCOMPATIBLE WITH RFC[21]Illegal BamHI site found at 529
Illegal XhoI site found at 1050 - 23COMPATIBLE WITH RFC[23]
- 25INCOMPATIBLE WITH RFC[25]Illegal NgoMIV site found at 273
Illegal NgoMIV site found at 313
Illegal NgoMIV site found at 491 - 1000COMPATIBLE WITH RFC[1000]
Usage
1) Express something in mammal cell lines particularly in G1 phases or once in every cell cycle by stable transfecting it into cell line;
2) Use it as a human promoter by transient transfecting it into cells.
Source
The sequence was retrieved from Addgene. We got it from human genome through PCR using the following primers:
pKi67-F: ACCTCTGCCCTCCGCCAGCCG
pKi67-R: ACCCGGTGGCCCTACAGGCTACG
(Product: 360)
Promoter function confirmation
G1 promoter function confirmation by transient transfection using 293T cells. Photos taken 48 hours after transient transfection, 10x. pCDK4, pKi67 and pCCNE are our G1 promoters. pmPGK is the constitutive promoter of mouse PGK, it is a medium promoter, here used as a control.
Reference
1. Pei, D.S., et al., Analysis of human Ki-67 gene promoter and identification of the Sp1 binding sites for Ki-67 transcription. Tumour Biol, 2012. 33(1): p. 257-66.
//collections
//promoter
None |