Help:Terminators

Revision as of 23:07, 21 November 2006 by Scmohr (Talk | contribs)

Part icon terminator.png Browse terminator parts!

A terminator (short for "transcriptional terminator") is a stretch of DNA which halts the process of transcription (making the RNA copy of a DNA sequence).


Stem-loop type terminators

An example of a stem-loop coding region (location indicated by the hairpin picture) in Part:BBa_B0011

In our prokaryotic BioBrick host cells these terminator parts are often palindromic (same sequence backwards and forwards on the two DNA strands) and the RNA transcript (the second half of which is the reverse complement of the first half) forms a stem-loop structure by folding back on itself. This structure then terminates transcription.
One example of a BioBrick which uses this method is the terminator Part:BBa_B0011, which has the sequence"aaaagccagattattaatccggctttt" on one DNA strand. The corresponding RNA transcript (with U's in place of T's) can fold back into a hairpin with the green nucleotides running right-to-left and the red left-to-right. (Try drawing out the base-paired structure -- the middle of the hairpin has three unpaired bases and the stem has one mismatch.)

Poly-A tails

In eukaryotic hosts such as yeast, a string of adenosine ("A") nucleotides is the primary method through which termination of transcription occurs. This is mediated by exonucleases (enzymes which cut at this recognition sequence). A popular "poly-A" motif is "AAUAAA".

Rho type terminators

Another method which cells use to terminate a sequence is through the action of the Rho protein.