New pages
(newest | oldest) View (newer 50 | older 50) (20 | 50 | 100 | 250 | 500)
- 14:27, 24 September 2024 Part:BBa K5378000:Hard Information (hist) [3,106 bytes] Zhaopan (Talk | contribs) (Created page with "<html lang="zh"> <head> <meta charset="UTF-8"> <meta name="viewport" content="width=device-width, initial-scale=1.0"> <title>Usage and Biology</title> <style>...")
- 13:29, 24 September 2024 Confirm Login (hist) [402 bytes] Zxa666 (Talk | contribs) (trial)
- 11:12, 20 September 2024 Part:BBa K5321000&action=edit§ion=1 (hist) [0 bytes] Yiyanliao (Talk | contribs) (Created page with "===Usage and Biology=== Spinach 2.1 RNA can bind and activate the fluorophore [http://pubs.acs.org/doi/abs/10.1021/ja410819x DFHBI-1T], both in vivo and in vitro. RNA molecul...")
- 12:51, 7 September 2024 Part:BBa K5226064:Design (hist) [434 bytes] Admin (Talk | contribs) (Created page with "__NOTOC__ <partinfo>BBa_K5226063 short</partinfo> <partinfo>BBa_K5226063 SequenceAndFeatures</partinfo> ===Design Notes=== none ===Source=== PCR amplification.Sequence...") originally created as "Part:BBa K5226063:Design"
- 12:46, 7 September 2024 Part:BBa K5226064 (hist) [1,433 bytes] Admin (Talk | contribs) (Created page with " <partinfo>BBa_K5226063 short</partinfo> <h2>Sequence and Features</h2> <partinfo>BBa_K5226063 SequenceAndFeatures</partinfo> <html> <body> <h2>Introduction</h2> <p> <br> One...") originally created as "Part:BBa K5226063"
- 19:07, 30 January 2024 Part:BBa T20245 (hist) [4 bytes] Vinoo (Talk | contribs) (Created page with "test")
- 14:29, 12 October 2023 Part:BBa K4692000:Hard Information (hist) [1,449 bytes] Shamlan (Talk | contribs) (Created page with "ATGAGATTCCCATCCATCTTCACTGCTGTTTTGTTTGCTGCTTCCTCTGCTTTGGCCGCTCCAGTTAACACCACCACTGAAGACGAAACTGCTCAAATCCCAGCTGAAGCTGTTATCGGTTATTTAGACTTAGAAGGTGACTTCGATGTCGCAGTTTTGCCATTCTCCAATTCCA...")
- 12:07, 12 October 2023 Part:BBa K4990013:Sequence, Features, and Subparts (hist) [893 bytes] ChenLiang (Talk | contribs) (Created page with " As HokB belongs to the Hok/Gef family, it is predicted to be a single-span membrane peptide，which is a single-span membrane peptide with a long, negatively charged C-ter...")
- 11:13, 12 October 2023 Part:BBa K4712062:Hard Information (hist) [566 bytes] Ke-666 (Talk | contribs) (Created page with "<style type="text/css"> .tg {border-collapse:collapse;border-spacing:0;} .tg td{border-color:black;border-style:solid;border-width:1px;font-family:Arial, sans-serif;font-size...")
- 18:12, 11 October 2023 Part:BBa K4614301 (hist) [411 bytes] Hyhhhhh (Talk | contribs) (T7-flgH-spytag-Lnak-R5)
- 00:14, 11 October 2023 ASU iGEM 2023 (hist) [1,696 bytes] Phjiang (Talk | contribs) (Welcome to the 2023 ASU iGEM page! This page serves as a compendium for our parts, as well as a short description of our team!)
- 23:46, 10 October 2023 IGEM23 ASU (hist) [46 bytes] Phjiang (Talk | contribs) (Welcome to the 2023 ASU iGEM page! This page serves as a compendium for our parts, as well as a short description of our team!)
- 12:22, 9 October 2023 Collections/Steroid Biosynthesis (hist) [68 bytes] Thalexander (Talk | contribs) (De Novo Steroid Biosynthesis Enzyme Pathway - Yeast Focus - (BOKU Vienna 2023))
- 00:43, 8 October 2023 Pqqgdh (hist) [53 bytes] Cndraben (Talk | contribs) (test)
- 08:50, 3 October 2023 Hmb-production-pathway.png (hist) [67 bytes] JenL (Talk | contribs) (Created page with "hmb-production-pathway.png")
- 10:09, 2 October 2023 Img-6632.pdf (hist) [67 bytes] JenL (Talk | contribs) (Created page with "https://static.igem.wiki/teams/4743/wiki/buteurace-logo-final-3.jpg")
- 09:08, 29 September 2023 Part:BBa K4650006:Hard Information (hist) [685 bytes] Hui Ching (Talk | contribs) (Created page with "BBa_K4650006 contained BBa_K4650000+BBa_K4650003+BBa_K4650001(pGal1,10- MaSp2-CBD) and was transformed into BY4741 to make the BY4741 containing BBa_K4650006 as one of the exp...")
- 08:58, 29 September 2023 Part:BBa K4650005:Hard Information (hist) [688 bytes] Hui Ching (Talk | contribs) (Created page with "BBa_K4650005 contained BBa_K4650000+BBa_K4650002+BBa_K4650001 (pGal1,10-MaSp1-CBD) and was transformed into BY4741 to make the BY4741 containing BBa_K4650005 as one of the exp...")
- 15:31, 28 September 2023 Part:BBa K4584000 (hist) [3,321 bytes] Markiva (Talk | contribs) (Corynebacter glutamicum LldR)
- 05:31, 28 September 2023 Scu-bse-p1.jpg (hist) [53 bytes] 18380928174 (Talk | contribs) (Created page with "https://static.igem.wiki/teams/4937/wiki/parts/p1.jpg")
- 12:04, 13 September 2023 Part:BBa K4806205 (hist) [5,544 bytes] Lulang (Talk | contribs) (Created page with "<html> <style> .bild {max-width: 100% ; height: auto;} .unterschrift {font-size: 11.5px;} </style> <h1>CYP2D6 gene with HA-tag for <i>Chlamydomonas reinhardtii</i> (Ph...")
- 06:29, 14 August 2023 Part:BBa K4790037:Hard Information (hist) [144 bytes] ZWing (Talk | contribs) (Created page with "This primer is the reverse to ASR1-Y6A-F(BBa_K4790036). Both primers were designed to mutate base sequence coding the 6th amino acid of node 59.")
- 01:56, 14 August 2023 Part:BBa K4790064:Sequence, Features, and Subparts (hist) [637 bytes] ZWing (Talk | contribs) (Created page with "Firstly, we use profile-HMM algorithm instead of BLAST local alignment algorithm. To obtain PETase-related protein sequences from all species, Pfam entries and HMMER web serve...")
- 01:41, 14 October 2022 Part:BBa K4342033 (hist) [5,118 bytes] Jeffreywchuong (Talk | contribs) (Created page with " __NOTOC__ <partinfo>BBa_K4342032 short</partinfo> <h1>Introduction</h1> File:intro-part-figure.png The 2022 UT Austin iGEM Team’s Part Collecti...")
- 15:34, 12 October 2022 Part:BBa K4237049:Sequence, Features, and Subparts (hist) [0 bytes] 1Long2333 (Talk | contribs) (Created page with "===BNSC-China=== We crossed the constitutive promoters of the J23 family (J23119, J23100, J23104, J23113) in prokaryotes as well as plac with several artificially designed pr...")
- 00:07, 12 October 2022 Part:BBa K4361000:Design (hist) [396 bytes] Larsvdb (Talk | contribs) (Created page with " __NOTOC__ <partinfo>BBa_K4361000 short</partinfo> <partinfo>BBa_K4361000 SequenceAndFeatures</partinfo> ===Design Notes=== Ensure it complies with BioBrick standards. =...")
- 16:10, 11 October 2022 Part:BBa K4228017:Hard Information (hist) [760 bytes] Fork (Talk | contribs) (→Brife introduction)
- 13:36, 11 October 2022 Part:BBa K4275014 (hist) [384 bytes] Jerryatcg (Talk | contribs) (Created page with " __NOTOC__ <partinfo>BBa_K4275014 short</partinfo> 1 <!-- Add more about the biology of this part here ===Usage and Biology=== <!-- --> <span class='h3bb'>Sequence and Feat...")
- 09:18, 11 October 2022 K4285020 (hist) [215 bytes] MoritzTettenborn (Talk | contribs) (Created page with "CadA promotor This part is a synthesized version of the repressible promotor BioBrick BBa_K1724000 with flanking Golden Gate BsaI sites compatible for molecular cloning into...")
- 08:01, 9 October 2022 Part:BBa K4343103:Sequence, Features, and Subparts (hist) [1,369 bytes] TripleDye (Talk | contribs) (Created page with " __NOTOC__ <partinfo>BBa_K4343103 short</partinfo> EhElo9 encodes ∆-9 elongase from Emiliania huxleyi which functions in the Δ-9 elongase/desaturase pathway and could conv...")
- 07:29, 9 October 2022 Part:BBa K4343102:Sequence, Features, and Subparts (hist) [936 bytes] CSWCMrJi (Talk | contribs) (Created page with " __NOTOC__ <partinfo>BBa K4343102 short</partinfo> BgElo9 encodes ∆-9 elongase from Blattella germanica which functions in the Δ-9 elongase/desaturase pathway and could co...")
- 05:41, 9 October 2022 Part:BBa K4343124:Sequence, Features, and Subparts (hist) [954 bytes] Milulu (Talk | contribs) (Created page with " __NOTOC__ <partinfo>BBa_K4343124 short</partinfo> Derived from Y. lipolytica, YATin promotor is a specific DNA sequence upstream of the 5' end of a structural gene that can...")
- 05:37, 9 October 2022 Part:BBa K4343123:Sequence, Features, and Subparts (hist) [551 bytes] Milulu (Talk | contribs) (Created page with " __NOTOC__ <partinfo>BBa_K4343123 short</partinfo> Derived from Y. lipolytica, TEFin promotor is a specific DNA sequence upstream of the 5' end of a structural gene that can...")
- 05:35, 9 October 2022 Part:BBa K4343122:Sequence, Features, and Subparts (hist) [997 bytes] Milulu (Talk | contribs) (Created page with " __NOTOC__ <partinfo>BBa_K4343122 short</partinfo> Derived from Y. lipolytica, TEF promotor is a specific DNA sequence upstream of the 5' end of a structural gene that can be...")
- 05:30, 9 October 2022 Part:BBa K4343121:Sequence, Features, and Subparts (hist) [956 bytes] Milulu (Talk | contribs) (Created page with " __NOTOC__ <partinfo>BBa_K4343121 short</partinfo> Derived from Y. lipolytica, FBAin promotor is a specific DNA sequence upstream of the 5' end of a structural gene that can...")
- 05:26, 9 October 2022 Part:BBa K4343120:Sequence, Features, and Subparts (hist) [715 bytes] Milulu (Talk | contribs) (Created page with " __NOTOC__ <partinfo>BBa_K4343120 short</partinfo> Derived from Y. lipolytica, EXP promotor is a specific DNA sequence upstream of the 5' end of a structural gene that can be...")
- 05:22, 9 October 2022 Part:BBa K4343119:Sequence, Features, and Subparts (hist) [1,006 bytes] Milulu (Talk | contribs) (Created page with " __NOTOC__ <partinfo>BBa_K4343061 short</partinfo> LEU gene is also a commonly used screening marker in Y. lipolytica. Only strains with LEU gene can grow in the medium witho...")
- 05:17, 9 October 2022 Part:BBa K4343118:Sequence, Features, and Subparts (hist) [1,261 bytes] Milulu (Talk | contribs) (Created page with " __NOTOC__ <partinfo>BBa_K4343061 short</partinfo> URA gene is a commonly used screening marker in Y. lipolytica. Only strains with URA3 gene can grow in the medium without u...")
- 05:08, 9 October 2022 Part:BBa K4343117:Sequence, Features, and Subparts (hist) [488 bytes] Milulu (Talk | contribs) (Created page with "_NOTOC__ <partinfo>BBa_K4343117 short</partinfo> Derived from Y. lipoltiyca, XPR2t is a terminator a DNA sequence that terminates the transcription of RNAP. <!-- Add more ab...")
- 05:02, 9 October 2022 Part:BBa K4343116:Sequence, Features, and Subparts (hist) [491 bytes] Milulu (Talk | contribs) (Created page with " __NOTOC__ <partinfo>BBa_K4343061 short</partinfo> Derived from Y. lipoltiyca, lip2t is a terminator, a DNA sequence that terminates the transcription of RNAP. <!-- Add more...")
- 04:55, 9 October 2022 Part:BBa K4343115:Sequence, Features, and Subparts (hist) [492 bytes] Milulu (Talk | contribs) (Created page with " __NOTOC__ <partinfo>BBa_K4343061 short</partinfo> Derived from Y. lipoltiyca, lip2t is a terminator, a DNA sequence that terminates the transcription of RNAP. <!-- Add mor...")
- 04:31, 9 October 2022 Part:BBa K4343114:Sequence, Features, and Subparts (hist) [508 bytes] Milulu (Talk | contribs) (Created page with " __NOTOC__ <partinfo>BBa_K4343061 short</partinfo> Derived from Y. lipoltiyca, Cyc1t is a terminator a DNA sequence that terminates the transcription of RNA polymerase (RNAP)...")
- 12:34, 6 October 2022 Part:BBa K4361000 (hist) [7,380 bytes] Larsvdb (Talk | contribs) (Created page with " __NOTOC__ <partinfo>BBa_K4361000 short</partinfo> Shares nucleotides of BBa_K4361001, but in a scrambled order as to no longer allow specific binding. <!-- Add more about t...")
- 14:00, 1 October 2022 页面名称 (hist) [39 bytes] Flora778 (Talk | contribs) (Created page with "https://parts.igem.org/Part:BBa_K2086002")
- 08:45, 28 September 2022 Part:Blunt (hist) [6 bytes] Tigress K (Talk | contribs) (Created page with "tactag")
- 03:44, 19 August 2022 BBa K4180002 (hist) [223 bytes] TedChueh (Talk | contribs) (Created page with "__NOTOC__ <partinfo>BBa_K4180002 short</partinfo>")
- 02:34, 19 August 2022 BBa K4180003 (hist) [49 bytes] TedChueh (Talk | contribs) (Created page with "__NOTOC__ <partinfo>BBa_K4180001 short</partinfo>")
- 05:33, 30 July 2022 Part:BBa K4290011:Hard Information (hist) [38 bytes] Wqc0729 (Talk | contribs) (Created page with "CTCCGCCCATCGAATGGCCCATCACCGCGAGACGGTTG")
- 17:14, 12 July 2022 Collections/JUMP (hist) [1,258 bytes] Vinoo (Talk | contribs) (Created page with "{{Catalog/MainLinks}} {{Catalog/Curation}} {{TOCright}} Joint Universal Modular Plasmids (JUMP) is a modular vector platform for Golden Gate (PhytoBrick) and Biobrick assembl...")
- 17:41, 5 July 2022 Collections/Interlab 2022 (hist) [828 bytes] Vinoo (Talk | contribs) (Created page with " ===Interlab 2022 Experiment 1 Devices=== {{Template:Collection/Interlab_2022/Experiment_1/Parts}} ===Interlab 2022 Experiment 2 Devices=== {{Template:Collection/Interlab_20...")
