Search results (Hint: Try the special 'Search Parts' system on the main page)

Create the page "Rc" on this wiki! See also the search results found.

• Part:BBa K2541122
  ...E cleavage site (ARC) and forms a stem-loop. This structure sequesters the RC, and expression is ‘ON’. <text class="d" transform="translate(429.01 185.45)">RC</text>
  11 KB (1,328 words) - 09:00, 16 October 2018
• Part:BBa K2541123
  ...E cleavage site (ARC) and forms a stem-loop. This structure sequesters the RC, and expression is ‘ON’. <text class="d" transform="translate(429.01 185.45)">RC</text>
  11 KB (1,328 words) - 09:00, 16 October 2018
• Part:BBa K2541406
  ...E cleavage site (ARC) and forms a stem-loop. This structure sequesters the RC, and expression is ‘ON’. These short, modular heat-repressible RNA-base <text class="d" transform="translate(429.01 185.45)">RC</text>
  12 KB (1,492 words) - 09:08, 16 October 2018
• Part:BBa K2308002
  ...designed to be fused to the C-terminal of H subunit in the reaction center(RC) of <i>Rhodobacter sphaeroides 2.4.1.</i> </p> <p style="font-size: 10px;">Figure 1：Modelling of RC-sYFP2 (GIF)</p></center>
  4 KB (612 words) - 21:59, 1 November 2017
• Part:BBa K2350009:Design
  (RC) CAACGTTGTTGCCATTGCTGCTGGCATCGTGGTGTCACGC (RC) TCCAACAGAACGAACTGCTCCAGAACGAACCCCATCCGCG
  2 KB (239 words) - 16:54, 22 October 2017
• Part:BBa K4169014
  ...e, that is, the first A before RC was changed to T, and the eighth C after RC was changed to T
  2 KB (300 words) - 10:39, 13 October 2022
• Part:BBa K1896016
  This part contains the INP_RC-mGFPuv2 fusion protein controlled by a weak to medium constitutive pr [[Part:BBa_K1896008|INP_RC]] is a truncated Ice Nucleating Protein from which the N-terminal dom
  2 KB (234 words) - 20:26, 19 October 2016
• Part:BBa K1896017
  This part contains the INP_RC-streptavidin fusion protein controlled by a weak to medium constituti [[Part:BBa_K1896008|INP_RC]] is a truncated Ice Nucleating Protein from which the N-terminal dom
  1 KB (195 words) - 19:18, 19 October 2016
• Part:BBa K1896018
  This part contains the INP_RC-mSA2 fusion protein controlled by a weak to medium constitutive promo [[Part:BBa_K1896008|INP_RC]] is a truncated Ice Nucleating Protein from which the N-terminal dom
  2 KB (284 words) - 20:30, 19 October 2016
• Part:BBa K2350015:Design
  (RC) TCCAACAGAACGAACTGCTCCAGAACGAACCCCATCCGCG (RC) ATCGCATCGATCTGATGCTCCAGCAAGCGTTTTCCATACC
  2 KB (242 words) - 13:28, 21 October 2017
• Part:BBa K4169012
  ...s gene sequence.So we mutated its gene sequence, that is,the first C after RC was changed to T.
  2 KB (290 words) - 10:38, 13 October 2022
• Part:BBa K1896001
  ...on partner with [[Part:BBa_K1896015|mSA2]] and [[Part:BBa_K1896016|INP_RC]] ...cult fusion proteins, from left to right: non-fluorescent control, INP_RC-mGFPuv2 (weak promoter), mGFPuv2-streptavidin, mGFPuv2-mSA2, mGFPuv2
  2 KB (332 words) - 22:02, 21 October 2016
• Part:BBa K2541407
  <text class="d" transform="translate(429.01 185.45)">RC</text> <text class="e" transform="translate(123.8 185.45)">anti-RC</text>
  12 KB (1,488 words) - 09:10, 16 October 2018
• Part:BBa K3645004:Design
  Madej T, Lanczycki CJ, Zhang D, Thiessen PA, Geer RC, Marchler-Bauer A, Bryant SH. " MMDB and VAST+: tracking structural similar Madej T, Lanczycki CJ, Zhang D, Thiessen PA, Geer RC, Marchler-Bauer A, Bryant SH. " MMDB and VAST+: tracking structural similar
  727 B (97 words) - 20:04, 27 October 2020
• Part:BBa K4074059
  ...tents: </b> <br> lox71-Pveg(rc)-lox66(r) - spoVG - ilvE - T001, lox71-Pveg(rc)-lox66(r) - spoVG - bcaP - T002, Pveg - spoVG - kanR - T003, pELE3 <br>
  797 B (129 words) - 05:26, 20 October 2021
• Part:BBa K4169013
  ...51;, RNA thermometers will maintain the secondary stem-loop structure, and RC sequences will complement and pair with other bases, unable to recruit RNas
  2 KB (300 words) - 10:38, 13 October 2022
• Part:BBa K4169011
  ...51;, RNA thermometers will maintain the secondary stem-loop structure, and RC sequences will complement and pair with other bases, unable to recruit RNas
  2 KB (284 words) - 10:37, 13 October 2022
• Part:BBa K4169010
  ...51;, RNA thermometers will maintain the secondary stem-loop structure, and RC sequences will complement and pair with other bases, unable to recruit RNas
  2 KB (292 words) - 10:33, 13 October 2022
• Part:BBa K4256666
  ...ures(≤25°C), the ARC site (Anti RNase E cleavage site) matches with the RC site complementarily and forms a stem ring structure, which can not be cut
  3 KB (491 words) - 13:09, 12 October 2022
• Part:BBa K658016
  [1]Baldwin T, Devine JH, Heckel, RC, Lin, JW, Shadel GS. The complete nucleotide sequence of the lux regulon of
  12 KB (1,906 words) - 16:18, 10 May 2013