New pages
(newest | oldest) View (newer 50 | older 50) (20 | 50 | 100 | 250 | 500)
- 22:15, 21 October 2019 Part:BBa K3144009 (hist) [845 bytes] MariamEzzElArab (Talk | contribs) (Created page with "__NOTOC__ <partinfo>BBa_K3144001 short</partinfo> Inositol-3-phosphate is the precursor of Inositol. Inositol is an osmoprotectant which contributes to the formation of lipid...")
- 20:10, 21 October 2019 Part:BBa K1653002:Hard Information (hist) [23 bytes] DanielZhu (Talk | contribs) (→Usage and Biology)
- 17:45, 21 October 2019 Part:BBa K3122000:Hard Information (hist) [77 bytes] Laulara (Talk | contribs) (Created page with "<span style="font-size: 150%; font-weight: bold;">J23104+B0032+INP+YFP</span>")
- 16:26, 21 October 2019 Editing Part:BBa I746916 (hist) [3,987 bytes] FabianBaezner (Talk | contribs) (Created page with "==Characterization: Freiburg 2019== <b>Group:</b> Freiburg 2019 <br> <b>Author:</b> Fabian Bäzner <br> <b>Summary:</b> We demonstrated the non-peptide guided auto-secretion...")
- 13:52, 21 October 2019 Chlamydomonas reinhardtii parts (hist) [775 bytes] Eraetsch (Talk | contribs) (Created page with "< Back to Catalog ==Chlamy HUB collection== We have created the part collection „Chlamy-HUB Collection“ (Part number range: BBa_K2984000-BBa_K2984063). It co...")
- 19:07, 20 October 2019 Chlamydomonas reinhardtii (hist) [1,016 bytes] Chlamy Dima (Talk | contribs) (Created page with "=='''<i>Chlamydomonas reinhardtii</i>'''== <html> <i>Chlamydomonas reinhardtii</i> is a green microalga. The unicellular and genetically modifiable organism posses several cha...")
- 16:28, 20 October 2019 Chlamydomonas reinhardtii chassis (hist) [1,016 bytes] Sasina (Talk | contribs) (Created page with "=='''Chlamydomonas reinhardtii chassis'''== <html> <i>Chlamydomonas reinhardtii</i> is a sweetwater alga </html>")
- 12:23, 19 October 2019 Part:BBa K2942703:Hard Information (hist) [12 bytes] Lyt (Talk | contribs) (Created page with "<b>kkkkk</b>")
- 23:51, 18 October 2019 Commons:Protein Amount Assay with known BSA concentration (hist) [0 bytes] Psantos (Talk | contribs) (Created blank page)
- 02:21, 17 October 2019 Part:BBa K2771000:Hard Information (hist) [624 bytes] Lavenderxc (Talk | contribs) (Created page with " We constructed a gene Gene circuit : LuxR-Plux-GFP to measure the function of promoter Plux under GFP protein. Based on our experiments, we have provided detailed data for pa...")
- 15:35, 16 October 2019 Collections/Biofilm Regulation (hist) [71 bytes] Vinoo (Talk | contribs) (Created page with "{{Catalog/MainLinks}} {{TOCright}} {{Catalog/Curation/User_Collection}}")
- 13:04, 16 October 2019 Part:BBa K3040100:Hard Information (hist) [487 bytes] Liya (Talk | contribs) (Created page with "Lipase from Antarctic cold-tolerant Pseudomonas sp. 7323 can catalyze the hydrolysis of triacylgly-cerols to glycerol and monoacyl-glycerols. We utilize the characteristic of...")
- 18:52, 15 October 2019 K3110048 (hist) [416 bytes] Swapnil B (Talk | contribs) (Created page with " __NOTOC__ <partinfo>BBa_K3110048 short</partinfo> Amartya and Swapnil fill in this. <!-- Add more about the biology of this part here ===Usage and Biology=== <!-- --> <spa...")
- 18:21, 15 October 2019 Part:BBa K3144002:Hard Information (hist) [446 bytes] MariamEzzElArab (Talk | contribs) (Created page with "__NOTOC__ <partinfo>BBa_K3144000 short</partinfo> PHO89 is a sodium/phosphate symporter from Debaryomyces hansenii <!-- Add more about the biology of this part here ===Usag...")
- 16:46, 15 October 2019 Part:BBa K3040004:Hard Information (hist) [17 bytes] KatrinaLai (Talk | contribs) (Created page with "gfjjkhjlh")
- 16:40, 15 October 2019 Creating Part:BBa K3040003 (hist) [721 bytes] KatrinaLai (Talk | contribs) (Created page with "pFadD promoter is one of the regulator in the enzymes of fatty acid biosynthesis in E. coli. It is composed of two fadR recognition sites, and one CRP binding site. The fatty...")
- 16:36, 15 October 2019 Creating Part:BBa K3040512:Hard Information (hist) [721 bytes] KatrinaLai (Talk | contribs) (Created page with "pFadD promoter is one of the regulator in the enzymes of fatty acid biosynthesis in E. coli. It is composed of two fadR recognition sites, and one CRP binding site. The fatty...") originally created as "Creating Part:BBa K3040013:Hard Information"
- 17:34, 4 October 2019 K3098002 (hist) [250 bytes] Etzel (Talk | contribs) (Created page with "GxCesB GxCesB protein could interacts with GxCesA protein (K3098001) via its C-terminal transmembrane helix as an auxiliary subunit. In bacteria, GxCesA and GxCesB proteins re...")
- 12:53, 26 August 2019 Promoters/Catalog/Cell Signalling (hist) [0 bytes] Thorged (Talk | contribs) (fus)
- 19:30, 6 August 2019 Part:BBa K3229294:Hard Information (hist) [15 bytes] Antonberg (Talk | contribs) (Created page with "TTTCTCCTCTTTAAT") originally created as "Part:BBa K3229215:Hard Information"
- 12:09, 6 August 2019 Characterization of Parts/Signalling (hist) [3 bytes] Alejandrcastro (Talk | contribs) (Created page with "...")
- 16:07, 29 November 2018 Loop Assembly (hist) [8,871 bytes] Vinoo (Talk | contribs) (Created page with "iGEM is currently evaluating Type IIS assembly methods for the Registry and the 2019 iGEM Competition. Since 2016, iGEM has allowed teams to submit parts in the PhytoBricks (T...")
- 15:46, 8 November 2018 RCLONE Mscarlet Blue AM.png (hist) [61 bytes] Juliapharr (Talk | contribs) (Created page with "<center> 500px </center>")
- 15:11, 8 November 2018 J100465 (hist) [1,896 bytes] JaneDiGregorio (Talk | contribs) (Created page with "Part number: J100465 Sequence: pCloneRed_Thurs_AM_Yellow_Top: 5'-CGACAGTTTTTGACACTTTCATAACACCAAGCAACTAATATATAATCTATAACATACAA pCloneRed_Thurs_AM_Yellow_Bottom: 5'-CCGCT...")
- 10:40, 17 October 2018 Part:J61101 (hist) [2,336 bytes] Adrireq (Talk | contribs) (Created page with "===Contribution=== Group: Valencia_UPV iGEM 2018 <br> Author: Adrián Requena Gutiérrez, Carolina Ropero <br> Summary: We adapted the part to be able to assemble transcriptio...")
- 15:25, 16 October 2018 Parts:BBa K2753030 (hist) [0 bytes] CharlesW (Talk | contribs) (Created page with " __NOTOC__ <partinfo>BBa_K2753030 short</partinfo> A member of the pTALE stabilized promoter family, characterized and sequenced by team GreatBay_China 2018. ===An Introduct...")
- 15:24, 15 October 2018 Part:BBa K2550000:Composite Edit (hist) [0 bytes] Janetstandeven (Talk | contribs) (Created page with "Hello")
- 16:55, 12 October 2018 Part:BBa K2751001:Experience (hist) [621 bytes] HANSONGTSENG (Talk | contribs) (Created page with "_NOTOC__ This experience page is provided so that any user may enter their experience using this part.<BR>Please enter how you used this part and how it worked out. ===Applic...")
- 16:54, 12 October 2018 Part:BBa K2751001:Design (hist) [162 bytes] HANSONGTSENG (Talk | contribs) (Created page with "__NOTOC__ <partinfo>BBa_K2751001 short</partinfo> <partinfo>BBa_K2751001 SequenceAndFeatures</partinfo> ===Design Notes=== ===Source=== ===References===")
- 16:53, 12 October 2018 Part:BBa K2751001 (hist) [382 bytes] HANSONGTSENG (Talk | contribs) (Created page with " __NOTOC__ <partinfo>BBa_K2751001 short</partinfo> <!-- Add more about the biology of this part here ===Usage and Biology=== <!-- --> <span class='h3bb'>Sequence and Featur...")
- 20:58, 11 October 2018 Group:iGEM18 BostonU (hist) [3,165 bytes] Csleach (Talk | contribs) (Created page with "== Welcome! == This is the Team BostonU 2018 (AKA "Project Leo") registry page. It is mostly for pointing to other things, if you somehow got here. [https://2018.igem.org/Te...")
- 14:14, 11 October 2018 Part:BBa K281800 (hist) [21 bytes] Dannyteo92 (Talk | contribs) (Created page with "==Usage and Biology==")
- 20:58, 10 October 2018 Part:BBa K2550002:Hard Information (hist) [168 bytes] Janetstandeven (Talk | contribs) (Created page with "CGCGTACGCgaattcgcggccgcttctagagTAATACGACTCACTATAGGGAGATTCTGTATACGAAAATATCTTATCATTATATATGAACAGAGGAGATATAATATGAAGATATTTAACCTGGCGGCAGCGCAAAAGtactagtagcggccgctgcagCGCGTACGC")
- 08:51, 8 October 2018 Part:BBa K2539300:Hard Information (hist) [3,057 bytes] Juster (Talk | contribs) (Created page with "Construct Design This construct was built to overexpress alcR, a regulatory protein necessary for the activation of PalcA. We acquired all parts from the iGEM distribution kit...")
- 05:50, 8 October 2018 Part:BBa K2539550:Hard Information (hist) [19 bytes] Juster (Talk | contribs) (Created page with "Hi, this is a test.")
- 01:34, 6 October 2018 Part:BBa 1491002 (hist) [0 bytes] Shengyi (Talk | contribs) (Created page with "creat")
- 19:20, 3 October 2018 Collections/BIOFAB (hist) [71,756 bytes] Vinoo (Talk | contribs) (Created page with "{{Catalog/MainLinks}} {{TOCright}} {{Catalog/Curation/User_Collection}} ==BioFAB== ===Modular Promoters=== <parttable>coll_biofab_promoter_modular</parttable> ===Random P...") originally created as "Collections/BioFAB"
- 11:56, 21 September 2018 Part:BBa K2729002 (hist) [1,785 bytes] MiyamotoKotaro (Talk | contribs) (Created page with "__NOTOC__ <partinfo>BBa_K2729002 short</partinfo> ===Usage and Biology=== 基本情報 Flavivirus capsid (C) is a structural protein responsible for gathering the viral RNA...")
- 09:07, 20 September 2018 BBa K2593002 (hist) [280 bytes] Lihuimin (Talk | contribs) (Created page with "Currently His-tags have been extensively applied for recombinant protein expression. Based on previous research, 6His-tag could provide enough spacing for protein folding to p...")
- 06:50, 20 September 2018 Part:BBa K2729003:Design (hist) [409 bytes] Ito (Talk | contribs) (Created page with "__NOTOC__ <partinfo>BBa_K2729003 short</partinfo> <partinfo>BBa_K2729003 SequenceAndFeatures</partinfo> ===Design Notes=== None ===Source=== NCBI https://www.ncbi.nlm.n...")
- 06:48, 20 September 2018 Part:BBa K2729003 (hist) [1,821 bytes] Ito (Talk | contribs) (Created page with " __NOTOC__ <partinfo>BBa_K2729003 short</partinfo> ===Usage and Biology=== 基本情報 Flavivirus capsid (C) is a structural protein responsible for gathering the viral RN...")
- 06:46, 20 September 2018 Part:BBa K2729001 (hist) [1,821 bytes] MiyamotoKotaro (Talk | contribs) (Created page with " __NOTOC__ <partinfo>BBa_K2729000 short</partinfo> ===Usage and Biology=== 基本情報 Flavivirus capsid (C) is a structural protein responsible for gathering the viral RN...")
- 13:54, 19 September 2018 Part:BBa K25990010 (hist) [3,680 bytes] Yen-ling (Talk | contribs) (.)
- 07:58, 18 September 2018 Part:BBa K2729000 (hist) [1,603 bytes] Hajime Fujita (Talk | contribs) (Created page with " see the [http://2017.igem.org/Team:TokyoTech/Experiment/Chimeric_Transcription_Factor “Chemeric Transcription Factor”]page")
- 09:24, 3 September 2018 Part:Bba K2810007 (hist) [1,119 bytes] Gparry75 (Talk | contribs) (Created page with "__NOTOC__ <partinfo>BBa_K2810007 short</partinfo> SP3_5_5 SP3 is a predicted secreted protein that localizes to [http://rspb.royalsocietypublishing.org/content/280/1750/2012...")
- 11:55, 2 September 2018 OprC (hist) [285 bytes] Jakobzubek (Talk | contribs) (OprC is an outer membrane copper specific transport porin.)
- 10:49, 31 August 2018 Part:BBa K2810008:Design (hist) [479 bytes] Ryancoates (Talk | contribs) (Created page with " __NOTOC__ <partinfo>BBa_K2810008 short</partinfo> <partinfo>BBa_K2810008 SequenceAndFeatures</partinfo> ===Design Notes=== Cloned into golden gate compatible pSB1C3 ===...")
- 10:42, 31 August 2018 Part:BBa K2810007:Design (hist) [479 bytes] Ryancoates (Talk | contribs) (Created page with " __NOTOC__ <partinfo>BBa_K2810007 short</partinfo> <partinfo>BBa_K2810007 SequenceAndFeatures</partinfo> ===Design Notes=== Cloned into golden gate compatible pSB1C3 (P1050...")
- 10:40, 31 August 2018 Part:BBa K2810008 (hist) [1,654 bytes] Ryancoates (Talk | contribs) (Created page with "__NOTOC__ <partinfo>BBa_K2810007 short</partinfo> SP3 is a predicted secreted protein that localizes to [http://rspb.royalsocietypublishing.org/content/280/1750/20121952 aphi...")
- 10:38, 31 August 2018 Part:BBa K2810007 (hist) [1,615 bytes] Ryancoates (Talk | contribs) (Created page with "__NOTOC__ <partinfo>BBa_K2810007 short</partinfo> SP3 is a predicted secreted protein that localizes to [http://rspb.royalsocietypublishing.org/content/280/1750/20121952 aphi...")