Part:BBa_K2172010
Tac Promoter-RBS-GST-Thrombin Protease-TEV-GFP-Terminator
This part is a gene circuit that can be used to test whether it is being expressed or not. It comprises of a ribosome binding site (RBS) for ribosomes to bind, a GST label for purification, a thrombin protease cleavage site plus a TEV protease cleavage site, a GFP detection unit, and a terminator. When transformed into bacteria, e.g. E. coli, it can be used to test whether the bacteria are expressing the part not. Other parts, such as the gene SmCPS1, can be inserted into this part via digestion on the thrombin site and the TEV site.
This circuit is responsible for the function of all sequence with a terminator waiting for the SmCPS1 protein to insert among Thrombin protease and TEV restriction cleavage sites. The above circuit without target gene SmCPS1 is constructed mainly to test whether it produces SmCPS1. If the circuit do work, it would result in the expression of the GFP gene and emission of green fluorescent light.
Name: BBa_K2172010 TAC-F primer: TCTAGATGACAATTAATCATCGGCT TE-R primer: ACTAGTATGTATTTAGAAAAATAAACAAATAGG Description: Promoter and RBS added, GST labeled, coding with Thrombin and TEV restriction enzyme cleavage sites, GFP detector, and Terminator. Function: See BBa_K2172010 in part registry. Length: 1719bp
Usage and Biology
Sequence and Features BBa_K2172010 SequenceAndFeatures Not understood
None |