Help:Terminators
Browse terminator parts!
A terminator (short for "transcriptional terminator") is a stretch of DNA which halts the process of transcription (making RNA to protein). Its sequence indicates the end of a functional operon (ie. a coding region attached to a regulatory region)
Stem-loop type terminators
In our prokaryotic biobricks, host cells, these terminator parts are often palindromic (same sequence backwards and forwards) and form a stem-loop structure by folding back on itself and terminates transcription in this way.
One example of a biobrick which uses this method is the terminator Part:BBa_B0011, which has the palindromic sequence "aaaagccagattattaatccggctttt"
Poly-A tails
In eukaryotic hosts such as yeast, a string of adenosine ("A") nucleotides is the primary method through which termination of transcription occurs. This is mediated by exonucleases (enzymes which cut at this recognition sequence). A popular "poly-A" motif is "AAUAAA".
Rho type terminators
Another method which cells use to terminate a sequence is through the action of the Rho protein.