Part:BBa_K3886022
Trace and Control System
Trace and Control System was used in Hidro Project by NDNF_China 2020.
Characterization
To dynamically monitor and control the engineered bacteria beyond the laboratory, we added DNA barcode system and kill switch to microbial genome through gene editing. The genetic circuits design is shown in the following diagram (Figure 1A & 1B). The genome-integrated Tracing and Control system offers tracking and specific killing of engineered strains in case of emergencies.
Figure 1: (A)The design scheme of Trace and Control System in Hidro; (B) The gel image of the result of genome integration of Trace and Control System into fimA site.
1. Tracing: Customizable Barcode and CRISPR-Cas12a nucleic acid testing offers the way to efficiently tracing engineered bacteria
In the Hidro system, in order to achieve Trace and Control, we have incorporated a DNA barcode into engineered strains, which stores user-defined information to distinguish engineered bacteria from natural bacteria. This Barcode can effectively help researchers track possible escaped bacterial individuals and distinct engineered strains or natural ones in an out-of-lab environment.
To design the desired barcode, we used https://earthsciweb.org/js/bio/dna-writer/ online tools to generate a DNA Barcode sequence to store 「NDNFChina2021」in the DNA sequence “CTCTACCTCGCTTCACGTCTGCTCACTCTGGTCCTAACAGCGATAGCGTCT” (Figure 2).
Since the Barcode needs to be subsequently detected by CRISPR-Cas12a based nucleic acids, we added the PAM sequence (TTTA) required for Cas12a at the 3' end of the Barcode. So the final sequence is "TTTACTCTACCTCGCTTCACGTCTGCTCACTCTGGTCCTAACAGCGATAGCGTCT".
Figure 2: The code table for translating information into DNA barcode.
After the DNA barcode "NDNFChinaiGEM202" has been integrated into the genome of E. coli. To enable efficient tracking of this barcode, we utilized the highly efficient CRISPR-Cas12a nucleic acid detection system. The steps to achieve this detection have been shown in Figure 3.
Figure 3: Steps in CRISPR-Cas12a-based nucleic acid detection system to track escaped strains from Hidro sytem
Sequence and Features
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21INCOMPATIBLE WITH RFC[21]Illegal BamHI site found at 1269
- 23COMPATIBLE WITH RFC[23]
- 25INCOMPATIBLE WITH RFC[25]Illegal NgoMIV site found at 1521
Illegal AgeI site found at 1104 - 1000INCOMPATIBLE WITH RFC[1000]Illegal SapI site found at 1086
| None |