Collections/BIOFAB

• Catalog
• Collections

This collection is a user contributed collection, and is not under curation by iGEM HQ/Registry.

This collection is undergoing curation by the 2021 FSU iGEM team...

How is the BIOFAB collection useful to you?

The BIOFAB collection contains over 250 promoters that are registered BioBricks parts. The promoters have a range of relative expression that spans four orders of magnitude. Promoters of different strengths can be selected from the BIOFAB collection based on desired expression levels. This allows the promoter strength to be varied when designing genetic constructs by selecting a promoter with a different relative strength. The BIOFAB promoters do not always display the expected expression strength. The observed expression strength is thought to vary depending on the genetic context. To ensure that a promoter with the desired strength is selected, the design should be tested with several different promoters of similar strengths. Using multiple promoters increases the likelihood that at least one promoter will display the desired strength.

How does it work?

The promoters on this page are listed in order of decreasing strength. The strongest promoters produce the most RNA transcripts of their downstream gene, while the weakest promoters produce the fewest RNA transcripts. The promoter strength is determined by how strongly the DNA sequence recruits RNA polymerase. Stronger promoters are better able to recruit RNA polymerase, so they cause transcription to occur more frequently. Weaker promoters cannot recruit RNA polymerase as effectively, so they cause transcription to occur less frequently.

How was it built?

The 2018 FSU iGEM team measured the expression levels of three BIOFAB promoters in iGEM plasmids. A test device was created, which contained a BIOFAB promoter, a ribosome binding site (part B0034), a red fluorescent protein (part mRFP1 E1010), and a double terminator(part B0015). (make the names of these parts hyperlinks to their webpages) The test device was incorporated into the plasmid pSB1C3, which gives transformed bacteria resistance to chloramphenicol.

[plasmid map]

The test device was created by combining the pSB1C3 backbone with two overlapping DNA inserts. The first insert contained the biobrick prefix, the BIOFAB promoter, and part of the mRFP1 gene. The second insert contained the full mRFP1 gene, the double terminator, and the biobrick suffix. The three DNA sequences were then combined into one plasmid using the NEB Hifi DNA Assembly Master Mix protocol. This procedure combines multiple pieces of DNA that share overlapping sequences into a single DNA molecule. The partial mRFP1 sequence on the first insert overlaps with the full mRFP1 gene on the second insert, so the Hifi Assembly method combines the two inserts into a single DNA oligo. The combined insert begins with a biobrick prefix and ends with a biobrick suffix, which overlap with the prefix and suffix that are found on the plasmid. Once the insert is assembled into the plasmid, the final plasmid is complete.

Libraries

Modular Promoter Library

apFAB46	iGEM Part: BBa_M36303
apFAB70	iGEM Part: BBa_K2832101
apFAB71	iGEM Part: BBa_K2832102
apFAB61	857iGEM Part:
apFAB80	787iGEM Part:
apFAB45	785.309iGEM Part:
apFAB47	782.004iGEM Part:
apFAB31	781.826iGEM Part:
apFAB55	768.983iGEM Part:
apFAB68	766.301iGEM Part:
apFAB101	757.959iGEM Part:
apFAB96	748.822iGEM Part:
apFAB56	743.476iGEM Part:
apFAB81	742.631iGEM Part:
apFAB92	742.334iGEM Part:
apFAB72	737.59iGEM Part:
apFAB100	736.966iGEM Part:
apFAB76	736.51iGEM Part:
apFAB30	731.463iGEM Part:
apFAB79	728.654iGEM Part:
apFAB75	717.72iGEM Part:
apFAB50	707.166iGEM Part:
apFAB93	706.957iGEM Part:
apFAB60	700.31iGEM Part:
apFAB54	690.839iGEM Part:
apFAB62	687.948iGEM Part:
apFAB42	685.34iGEM Part:
apFAB53	682.888iGEM Part:
apFAB85	674.421iGEM Part:
apFAB65	670.065iGEM Part:
apFAB52	666.998iGEM Part:
apFAB67	649.993iGEM Part:
apFAB32	645.519iGEM Part:
apFAB57	637.488iGEM Part:
apFAB39	594.378iGEM Part:
apFAB115	573.792iGEM Part:
apFAB29	565.946iGEM Part:
apFAB77	555.565iGEM Part:
apFAB36	547.956iGEM Part:
apFAB44	540.856iGEM Part:
apFAB102	534.826iGEM Part:
apFAB37	530.604iGEM Part:
apFAB41	523.35iGEM Part:
apFAB63	518.502iGEM Part:
apFAB140	508.942iGEM Part:
apFAB64	508.117iGEM Part:
apFAB40	488.364iGEM Part:
apFAB97	477.744iGEM Part:
apFAB78	476.327iGEM Part:
apFAB69	474.513iGEM Part:
apFAB103	459.253iGEM Part:
apFAB73	456.758iGEM Part:
apFAB66	439.276iGEM Part:
apFAB126	433.829iGEM Part:
apFAB95	425.407iGEM Part:
apFAB151	422.838iGEM Part:
apFAB48	411.861iGEM Part:
apFAB82	389.529iGEM Part:
apFAB141	376.932iGEM Part:
apFAB150	366.498iGEM Part:
apFAB125	363.199iGEM Part:
apFAB33	340.476iGEM Part:
apFAB121	328.946iGEM Part:
apFAB111	327.288iGEM Part:
apFAB58	287.687iGEM Part:
apFAB94	279.605iGEM Part:
apFAB145	271.14iGEM Part:
apFAB118	267.819iGEM Part:
apFAB106	256.824iGEM Part:
apFAB110	254.676iGEM Part:
apFAB105	243.758iGEM Part:
apFAB38	239.875iGEM Part:
apFAB89	223.766iGEM Part:
apFAB142	214.923iGEM Part:
apFAB130	182.202iGEM Part:
apFAB131	167.803iGEM Part:
apFAB143	157.015iGEM Part:
apFAB87	145.215iGEM Part:
apFAB104	126.832iGEM Part:
apFAB98	120.521iGEM Part:
apFAB51	103.187iGEM Part:
apFAB49	93.9231iGEM Part:
apFAB120	81.7515iGEM Part:
apFAB83	79.3039iGEM Part:
apFAB117	62.9585iGEM Part:
apFAB129	60.7537iGEM Part:
apFAB146	58.9582iGEM Part:
apFAB59	58.498iGEM Part:
apFAB127	48.3838iGEM Part:
apFAB88	48.354iGEM Part:
apFAB86	44.6204iGEM Part:
apFAB74	44.6094iGEM Part:
apFAB152	40.7219iGEM Part:
apFAB122	36.8209iGEM Part:
apFAB128	26.6541iGEM Part:
apFAB99	26.5471iGEM Part:
apFAB119	20.866iGEM Part:
apFAB112	17.3114iGEM Part:
apFAB34	14.6339iGEM Part:
apFAB147	13.3236iGEM Part:
apFAB144	13.0792iGEM Part:
apFAB35	12.6234iGEM Part:
apFAB107	11.4242iGEM Part:
apFAB123	11.2076iGEM Part:
apFAB137	7.09512iGEM Part:
apFAB113	5.32229iGEM Part:
apFAB84	4.73181iGEM Part:
apFAB148	4.01421iGEM Part:
apFAB108	3.64128iGEM Part:
apFAB114	3.35398iGEM Part:
apFAB136	3.19915iGEM Part:
apFAB124	2.64681iGEM Part:
apFAB149	3iGEM Part:
apFAB134	3iGEM Part:
apFAB138	2iGEM Part:
apFAB43	1iGEM Part:
apFAB133	0.84608iGEM Part:
apFAB139	0.681873
apFAB91	0.42395
apFAB90	0.378777

References

Mutalik, V., Guimaraes, J., Cambray, G. et al. Precise and reliable gene expression via standard transcription and translation initiation elements. Nat Methods 10, 354–360 (2013). https://doi.org/10.1038/nmeth.2404

The data visualization is provided by the Charts.css library. You can use the Charts.css 0.9.0 library in your wiki page by adding the FSU/ChartsCSS template to the page.

Tables Generated by the Parts Registry

Modular Promoters Table

More...

Name	Description	Type	Created by	length	uses	seq
BBa_K2832100	BIOFAB Modular Promoter apFAB46	Regulatory	BIOFAB	47	1	. . . cgcatctttttgtacctataatagattcat
BBa_K2832101	BIOFAB Modular Promoter apFAB70	Regulatory	BIOFAB	37		. . . cgcatctttttgtacctataatgtgtggat
BBa_K2832102	BIOFAB Modular Promoter apFAB71	Regulatory	BIOFAB	37		. . . cgcatctttttgtacctataatagattcat
BBa_K2832103	BIOFAB Modular Promoter apFAB61	Regulatory	BIOFAB	37		. . . ttaatcatccggctcgtataatagattcat
BBa_K2832104	BIOFAB Modular Promoter apFAB80	Regulatory	BIOFAB	49		. . . aagtctaacctataggtataatgtgtggat
BBa_K2832105	BIOFAB Modular Promoter apFAB45	Regulatory	BIOFAB	47		. . . cgcatctttttgtacctataatgtgtggat
BBa_K2832106	BIOFAB Modular Promoter apFAB47	Regulatory	BIOFAB	47		. . . cgcatctttttgtacccataattatttcat
BBa_K2832107	BIOFAB modular Promoter apFAB31	Regulatory	BIOFAB	48		. . . aagtctaacctataggtataatagattcat
BBa_K2832108	BIOFAB modular Promoter apFAB55	Regulatory	BIOFAB	38		. . . aagtctaacctataggtataatgtgtggat
BBa_K2832109	BIOFAB modular Promoter apFAB68	Regulatory	BIOFAB	37		. . . caggaaaatttttctgtagatttaacgtat
BBa_K2832110	BIOFAB modular Promoter apFAB101	Regulatory	BIOFAB	48		. . . ttatcccttgcggcgatataatagattcat
BBa_K2832111	BIOFAB Modular Promoter apFAB96	Regulatory	BIOFAB	48		. . . cgcatctttttgtacctataatagattcat
BBa_K2832112	BIOFAB Modular Promoter apFAB56	Regulatory	BIOFAB	38		. . . aagtctaacctataggtataatagattcat
BBa_K2832113	BIOFAB Modular Promoter apFAB81	Regulatory	BIOFAB	49		. . . aagtctaacctataggtataatagattcat
BBa_K2832114	BIOFAB Modular Promoter apFAB92	Regulatory	BIOFAB	48		. . . caggaaaatttttctgcataattatttcat
BBa_K2832115	BIOFAB Modular Promoter apFAB72	Regulatory	BIOFAB	37		. . . cgcatctttttgtacccataattatttcat
BBa_K2832116	BIOFAB Modular Promoter apFAB100	Regulatory	BIOFAB	48		. . . ttatcccttgcggcgatataatgtgtggat
BBa_K2832117	BIOFAB Modular Promoter apFAB76	Regulatory	BIOFAB	37		. . . ttatcccttgcggcgatataatagattcat
BBa_K2832118	BIOFAB Modular Promoter apFAB30	Regulatory	BIOFAB	48		. . . aagtctaacctataggtataatgtgtggat
BBa_K2832119	BIOFAB Modular Promoter apFAB79	Regulatory	BIOFAB	49		. . . aagtctaacctataggatacttacagccat
BBa_K2832120	BIOFAB Modular Promoter apFAB75	Regulatory	BIOFAB	37		. . . ttatcccttgcggcgatataatgtgtggat
BBa_K2832121	BIOFAB Modular Promoter apFAB50	Regulatory	BIOFAB	47		. . . ttatcccttgcggcgatataatgtgtggat
BBa_K2832122	BIOFAB Modular Promoter apFAB93	Regulatory	BIOFAB	48		. . . caggaaaatttttctgtagatttaacgtat
BBa_K2832123	BIOFAB Modular Promoter apFAB60	Regulatory	BIOFAB	37		. . . ttaatcatccggctcgtataatgtgtggat
BBa_K2832124	BIOFAB Modular Promoter apFAB54	Regulatory	BIOFAB	38		. . . aagtctaacctataggatacttacagccat
BBa_K2832125	BIOFAB Modular Promoter apFAB62	Regulatory	BIOFAB	37		. . . ttaatcatccggctcgcataattatttcat
BBa_K2832126	BIOFAB Modular Promoter apFAB42	Regulatory	BIOFAB	47		. . . caggaaaatttttctgcataattatttcat
BBa_K2832127	BIOFAB Modular Promoter apFAB53	Regulatory	BIOFAB	47		. . . ttatcccttgcggcgatagatttaacgtat
BBa_K2832128	BIOFAB Modular Promoter apFAB85	Regulatory	BIOFAB	48		. . . ttaatcatccggctcgtataatgtgtggat
BBa_K2832129	BIOFAB Modular Promoter apFAB65	Regulatory	BIOFAB	37		. . . caggaaaatttttctgtataatgtgtggat
BBa_K2832130	BIOFAB Modular Promoter apFAB52	Regulatory	BIOFAB	47		. . . ttatcccttgcggcgacataattatttcat
BBa_K2832131	BIOFAB Modular Promoter apFAB67	Regulatory	BIOFAB	37		. . . caggaaaatttttctgcataattatttcat
BBa_K2832132	BIOFAB Modular Promoter apFAB32	Regulatory	BIOFAB	48		. . . aagtctaacctataggcataattatttcat
BBa_K2832133	BIOFAB Modular Promoter apFAB57	Regulatory	BIOFAB	38		. . . aagtctaacctataggcataattatttcat
BBa_K2832134	BIOFAB Modular Promoter apFAB39	Regulatory	BIOFAB	47		. . . caggaaaatttttctgatacttacagccat
BBa_K2832135	BIOFAB Modular Promoter apFAB115	Regulatory	BIOFAB	37		. . . caggaaaatttttctgtataatgtgtggat
BBa_K2832136	BIOFAB Modular Promoter apFAB29	Regulatory	BIOFAB	48		. . . aagtctaacctataggatacttacagccat
BBa_K2832137	BIOFAB Modular Promoter apFAB77	Regulatory	BIOFAB	37		. . . ttatcccttgcggcgacataattatttcat
BBa_K2832138	BIOFAB Modular Promoter apFAB36	Regulatory	BIOFAB	47		. . . ttaatcatccggctcgtataatagattcat
BBa_K2832139	BIOFAB Modular Promoter apFAB44	Regulatory	BIOFAB	47		. . . cgcatctttttgtaccatacttacagccat
BBa_K2832140	BIOFAB Modular Promoter apFAB102	Regulatory	BIOFAB	48		. . . ttatcccttgcggcgacataattatttcat
BBa_K2832141	BIOFAB Modular Promoter apFAB37	Regulatory	BIOFAB	47		. . . ttaatcatccggctcgcataattatttcat
BBa_K2832142	BIOFAB Modular Promoter apFAB41	Regulatory	BIOFAB	47		. . . caggaaaatttttctgtataatagattcat
BBa_K2832143	BIOFAB Modular Promoter apFAB63	Regulatory	BIOFAB	37		. . . ttaatcatccggctcgtagatttaacgtat
BBa_K2832144	BIOFAB Modular Promoter apFAB140	Regulatory	BIOFAB	45		. . . caggaaaatttttctgtataatgtgtggat
BBa_K2832145	bIOFAB Modular Promoter apFAB64	Regulatory	BIOFAB	37		. . . caggaaaatttttctgatacttacagccat
BBa_K2832146	BIOFAB Modular Promoter apFAB40	Regulatory	BIOFAB	47		. . . caggaaaatttttctgtataatgtgtggat
BBa_K2832147	BIOFAB Modular Promoter apFAB97	Regulatory	BIOFAB	48		. . . cgcatctttttgtacccataattatttcat
BBa_K2832148	BIOFAB modular Promoter apFAB78	Regulatory	BIOFAB	37		. . . ttatcccttgcggcgatagatttaacgtat
BBa_K2832149	BIOFAB Modular Promoter apFAB69	Regulatory	BIOFAB	37		. . . cgcatctttttgtaccatacttacagccat
BBa_K2832150	BIOFAB Modular Promoter apFAB103	Regulatory	BIOFAB	48		. . . ttatcccttgcggcgatagatttaacgtat
BBa_K2832151	BIOFAB Modular Promoter apFAB73	Regulatory	BIOFAB	37		. . . cgcatctttttgtacctagatttaacgtat
BBa_K2832152	BIOFAB Modular Promoter apFAB66	Regulatory	BIOFAB	37		. . . caggaaaatttttctgtataatagattcat
BBa_K2832153	BIOFAB Modular Promoter apFAB126	Regulatory	BIOFAB	37		. . . ttatcccttgcggcgatataatagattcat
BBa_K2832154	BIOFAB Modular Promoter apFAB95	Regulatory	BIOFAB	48		. . . cgcatctttttgtacctataatgtgtggat
BBa_K2832155	BIOFAB Modular Promoter apFAB151	Regulatory	BIOFAB	45		. . . ttatcccttgcggcgatataatagattcat
BBa_K2832156	BIOFAB Modular Promoter apFAB48	Regulatory	BIOFAB	47		. . . cgcatctttttgtacctagatttaacgtat
BBa_K2832157	BIOFAB Modular Promoter apFAB82	Regulatory	BIOFAB	49	1	. . . aagtctaacctataggcataattatttcat
BBa_K2832158	BIOFAB Modular Promoter apFAB141	Regulatory	BIOFAB	45		. . . caggaaaatttttctgtataatagattcat
BBa_K2832159	BIOFAB Modular Promoter apFAB150	Regulatory	BIOFAB	45		. . . ttatcccttgcggcgatataatgtgtggat
BBa_K2832160	BIOFAB Modular Promoter apFAB125	Regulatory	BIOFAB	37		. . . ttatcccttgcggcgatataatgtgtggat
BBa_K2832161	BIOFAB Modular Promoter apFAB33	Regulatory	BIOFAB	48		. . . aagtctaacctataggtagatttaacgtat
BBa_K2832162	BIOFAB Modular Promoter apFAB121	Regulatory	BIOFAB	37		. . . cgcatctttttgtacctataatagattcat
BBa_K2832163	BIOFAB modular Promoter apFAB111	Regulatory	BIOFAB	37		. . . ttaatcatccggctcgtataatagattcat
BBa_K2832164	BIOFAB modular Promoter apFAB58	Regulatory	BIOFAB	38		. . . aagtctaacctataggtagatttaacgtat
BBa_K2832165	BIOFAB modular Promoter apFAB94	Regulatory	BIOFAB	48		. . . cgcatctttttgtaccatacttacagccat
BBa_K2832166	BIOFAB modular Promoter apFAB145	Regulatory	BIOFAB	45		. . . cgcatctttttgtacctataatgtgtggat
BBa_K2832167	BIOFAB Modular Promoter apFAB118	Regulatory	BIOFAB	37		. . . caggaaaatttttctgtagatttaacgtat
BBa_K2832168	BIOFAB Modular Promoter apFAB106	Regulatory	BIOFAB	38		. . . aagtctaacctataggtataatagattcat
BBa_K2832169	BIOFAB Modular Promoter apFAB110	Regulatory	BIOFAB	37		. . . ttaatcatccggctcgtataatgtgtggat
BBa_K2832170	BIOFAB Modular Promoter apFAB105	Regulatory	BIOFAB	38		. . . aagtctaacctataggtataatgtgtggat
BBa_K2832171	BIOFAB Modular Promoter apFAB38	Regulatory	BIOFAB	47		. . . ttaatcatccggctcgtagatttaacgtat
BBa_K2832172	BIOFAB Modular Promoter apFAB89	Regulatory	BIOFAB	48		. . . caggaaaatttttctgatacttacagccat
BBa_K2832173	BIOFAB Modular Promoter apFAB142	Regulatory	BIOFAB	45		. . . caggaaaatttttctgcataattatttcat
BBa_K2832174	BIOFAB Modular Promoter apFAB130	Regulatory	BIOFAB	46		. . . aagtctaacctataggtataatgtgtggat
BBa_K2832175	BIOFAB Modular Promoter apFAB131	Regulatory	BIOFAB	46		. . . aagtctaacctataggtataatagattcat
BBa_K2832176	BIOFAB Modular Promoter apFAB143	Regulatory	BIOFAB	45		. . . caggaaaatttttctgtagatttaacgtat
BBa_K2832177	BIOFAB Modular Promoter apFAB87	Regulatory	BIOFAB	48		. . . ttaatcatccggctcgcataattatttcat
BBa_K2832178	BIOFAB Modular Promoter apFAB104	Regulatory	BIOFAB	38		. . . aagtctaacctataggatacttacagccat
BBa_K2832179	BIOFAB Modular Promoter apFAB98	Regulatory	BIOFAB	48		. . . cgcatctttttgtacctagatttaacgtat
BBa_K2832180	BIOFAB Modular Promoter apFAB51	Regulatory	BIOFAB	47		. . . ttatcccttgcggcgatataatagattcat
BBa_K2832181	BIOFAB Modular Promoter apFAB49	Regulatory	BIOFAB	47		. . . ttatcccttgcggcgaatacttacagccat
BBa_K2832182	BIOFAB Modular Promoter apFAB120	Regulatory	BIOFAB	37		. . . cgcatctttttgtacctataatgtgtggat
BBa_K2832183	BIOFAB Modular Promoter apFAB83	Regulatory	BIOFAB	49		. . . aagtctaacctataggtagatttaacgtat
BBa_K2832184	BIOFAB Modular Promoter apFAB117	Regulatory	BIOFAB	37		. . . caggaaaatttttctgcataattatttcat
BBa_K2832185	BIOFAB Modular Promoter apFAB129	Regulatory	BIOFAB	46		. . . aagtctaacctataggatacttacagccat
BBa_K2832186	BIOFAB Modular Promoter apFAB146	Regulatory	BIOFAB	45		. . . cgcatctttttgtacctataatagattcat
BBa_K2832187	BIOFAB Modular Promoter apFAB59	Regulatory	BIOFAB	37		. . . ttaatcatccggctcgatacttacagccat
BBa_K2832188	BIOFAB Modular Promoter apFAB127	Regulatory	BIOFAB	37		. . . ttatcccttgcggcgacataattatttcat
BBa_K2832189	BIOFAB Modular Promoter apFAB88	Regulatory	BIOFAB	48		. . . ttaatcatccggctcgtagatttaacgtat
BBa_K2832190	BIOFAB Modular Promoter apFAB86	Regulatory	BIOFAB	48		. . . ttaatcatccggctcgtataatagattcat
BBa_K2832191	BIOFAB Modular Promoter apFAB74	Regulatory	BIOFAB	37		. . . ttatcccttgcggcgaatacttacagccat
BBa_K2832192	BIOFAB Modular Promoter apFAB152	Regulatory	BIOFAB	45		. . . ttatcccttgcggcgacataattatttcat
BBa_K2832193	BIOFAB Modular Promoter apFAB122	Regulatory	BIOFAB	37		. . . cgcatctttttgtacccataattatttcat
BBa_K2832194	BIOFAB Modular Promoter apFAB128	Regulatory	BIOFAB	37		. . . ttatcccttgcggcgatagatttaacgtat
BBa_K2832195	BIOFAB Modular Promoter apFAB99	Regulatory	BIOFAB	48		. . . ttatcccttgcggcgaatacttacagccat
BBa_K2832196	BIOFAB Modular Promoter apFAB119	Regulatory	BIOFAB	37		. . . cgcatctttttgtaccatacttacagccat
BBa_K2832197	BIOFAB Modular Promoter apFAB112	Regulatory	BIOFAB	37		. . . ttaatcatccggctcgcataattatttcat
BBa_K2832198	BIOFAB Modular Promoter apFAB34	Regulatory	BIOFAB	47		. . . ttaatcatccggctcgatacttacagccat
BBa_K2832199	BIOFAB Modular Promoter apFAB147	Regulatory	BIOFAB	45		. . . cgcatctttttgtacccataattatttcat
BBa_K2832200	BIOFAB Modular Promoter apFAB144	Regulatory	BIOFAB	45		. . . cgcatctttttgtaccatacttacagccat
BBa_K2832201	BIOFAB Modular Promoter apFAB35	Regulatory	BIOFAB	47		. . . ttaatcatccggctcgtataatgtgtggat
BBa_K2832202	BIOFAB modular Promoter apFAB107	Regulatory	BIOFAB	38		. . . aagtctaacctataggcataattatttcat
BBa_K2832203	BIOFAB modular Promoter apFAB123	Regulatory	BIOFAB	37		. . . cgcatctttttgtacctagatttaacgtat
BBa_K2832204	BIOFAB Modular Promoter apFAB137	Regulatory	BIOFAB	45		. . . ttaatcatccggctcgcataattatttcat
BBa_K2832205	BIOFAB Modular Promoter apFAB113	Regulatory	BIOFAB	37		. . . ttaatcatccggctcgtagatttaacgtat
BBa_K2832206	BIOFAB Modular Promoter apFAB84	Regulatory	BIOFAB	48		. . . ttaatcatccggctcgatacttacagccat
BBa_K2832207	BIOFAB Modular Promoter apFAB148	Regulatory	BIOFAB	45		. . . cgcatctttttgtacctagatttaacgtat
BBa_K2832208	BIOFAB Modular Promoter apFAB108	Regulatory	BIOFAB	38		. . . aagtctaacctataggtagatttaacgtat
BBa_K2832209	BIOFAB Modular Promoter apFAB114	Regulatory	BIOFAB	37		. . . caggaaaatttttctgatacttacagccat
BBa_K2832210	BIOFAB Modular Promoter apFAB136	Regulatory	BIOFAB	45		. . . ttaatcatccggctcgtataatagattcat
BBa_K2832211	BIOFAB Modular Promoter apFAB124	Regulatory	BIOFAB	37		. . . ttatcccttgcggcgaatacttacagccat
BBa_K2832212	BIOFAB Modular Promoter apFAB149	Regulatory	BIOFAB	45		. . . ttatcccttgcggcgaatacttacagccat
BBa_K2832213	BIOFAB Modular Promoter apFAB134	Regulatory	BIOFAB	45		. . . ttaatcatccggctcgatacttacagccat
BBa_K2832214	BIOFAB Modular Promoter apFAB138	Regulatory	BIOFAB	45		. . . ttaatcatccggctcgtagatttaacgtat
BBa_K2832215	BIOFAB Modular Promoter apFAB43	Regulatory	BIOFAB	47		. . . caggaaaatttttctgtagatttaacgtat
BBa_K2832216	BIOFAB Modular Promoter apFAB133	Regulatory	BIOFAB	46		. . . aagtctaacctataggtagatttaacgtat
BBa_K2832217	BIOFAB Modular Promoter apFAB139	Regulatory	BIOFAB	45		. . . caggaaaatttttctgatacttacagccat
BBa_K2832218	BIOFAB Modular Promoter apFAB91	Regulatory	BIOFAB	48		. . . caggaaaatttttctgtataatagattcat
BBa_K2832219	BIOFAB Modular Promoter apFAB90	Regulatory	BIOFAB	48	1	. . . caggaaaatttttctgtataatgtgtggat

Randomized Promoters Table

More...

Name	Description	Type	Created by	length	uses	seq
BBa_J97008	BIOFAB Random Promoter apFAB342	Regulatory	BIOFAB	36	-1	. . . attaatcatccggctcataaaatttgtgga
BBa_K3702000	BIOFAB Random Promoter apFAB347	Regulatory	BIOFAB	36	-1	. . . attaatcatccggctcttaatatgtgtgga
BBa_K3702001	BIOFAB Random Promoter apFAB345	Regulatory	BIOFAB	36	-1	. . . attaatcatccggctcgtagagtatgtgga
BBa_K3702002	BIOFAB Random Promoter apFAB341	Regulatory	BIOFAB	36	-1	. . . attaatcatccggctcgtaatatgtgtgga
BBa_K3702003	BIOFAB Random Promoter apFAB317	Regulatory	BIOFAB	36	-1	. . . tttaatcatccggctcgtataatgtgtgga
BBa_K3702004	BIOFAB Random Promoter apFAB338	Regulatory	BIOFAB	36	-1	. . . attaatcatccggctcctaggatgtgtgga
BBa_K3702005	BIOFAB Random Promoter apFAB323	Regulatory	BIOFAB	36	-1	. . . tttaatcatccggctcgtataatgtgtgga
BBa_K3702006	BIOFAB Random Promoter apFAB339	Regulatory	BIOFAB	36	-1	. . . attaatcatccggctcgtaatttatgtgga
BBa_K3702007	BIOFAB Random Promoter apFAB321	Regulatory	BIOFAB	36	-1	. . . attaatcatccggctcgtaacttatgtgga
BBa_K3702008	BIOFAB Random Promoter apFAB340	Regulatory	BIOFAB	36	-1	. . . attaatcatccggctcgtagtatgtgtgga
BBa_K3702009	BIOFAB Random Promoter apFAB322	Regulatory	BIOFAB	36	-1	. . . attaatcatccggctcgtataatgtgtgga
BBa_K3702010	BIOFAB Random Promoter apFAB346	Regulatory	BIOFAB	36	-1	. . . attaatcatccggctcgtaatgtttgtgga
BBa_K3702011	BIOFAB Random Promoter apFAB303	Regulatory	BIOFAB	35	-1	. . . tcttaatcatcggctcgtataatgtgtgga
BBa_K3702012	BIOFAB Random Promoter apFAB302	Regulatory	BIOFAB	36	-1	. . . tttaatcatccggctcgtataatgtgtgga
BBa_K3702013	BIOFAB Random Promoter apFAB297	Regulatory	BIOFAB	36	-1	. . . tttaatcatccggctcgtataatgtgtgga
BBa_K3702014	BIOFAB Random Promoter apFAB301	Regulatory	BIOFAB	36	-1	. . . tttaatcatccggctcgtataatgtgtgga
BBa_K3702015	BIOFAB Random Promoter apFAB298	Regulatory	BIOFAB	36	-1	. . . cttaatcatccggctcgtataatgtgtgga
BBa_K3702016	BIOFAB Random Promoter apFAB306	Regulatory	BIOFAB	36	-1	. . . attaatcatccggctcgtagtgtttgtgga
BBa_K3702017	BIOFAB Random Promoter apFAB307	Regulatory	BIOFAB	36	-1	. . . attaatcatccggctcatatcgtttgtgga
BBa_K3702018	BIOFAB Random Promoter apFAB296	Regulatory	BIOFAB	36	-1	. . . tttaatcatccggctcgtataatgtgtgga
BBa_K3702019	BIOFAB Random Promoter apFAB308	Regulatory	BIOFAB	36	-1	. . . attaatcatccggctcgtaggttatgtgga
BBa_K3702020	BIOFAB Random Promoter apFAB295	Regulatory	BIOFAB	35	-1	. . . tcttaatcatcggctcgtataatgtgtgga
BBa_K3702021	BIOFAB Random Promoter apFAB300	Regulatory	BIOFAB	36	-1	. . . cttaatcatccggctcgtataatgtgtgga
BBa_K3702022	BIOFAB Random Promoter apFAB299	Regulatory	BIOFAB	36	-1	. . . tttaatcatccggctcgtataatgtgtgga
BBa_K3702023	BIOFAB Random Promoter apFAB309	Regulatory	BIOFAB	36	-1	. . . attaatcatccggctcgtagtgtctgtgga
BBa_K3702024	BIOFAB Random Promoter apFAB305	Regulatory	BIOFAB	36	-1	. . . attaatcatccggctcgtagggtttgtgga
BBa_K3702025	BIOFAB Random Promoter apFAB313	Regulatory	BIOFAB	36	-1	. . . attaatcatccggctcttagggtgtgtgga
BBa_K3702026	BIOFAB Random Promoter apFAB310	Regulatory	BIOFAB	36	-1	. . . attaatcatccggctcctatcttctgtgga
BBa_K3702027	BIOFAB Random Promoter apFAB311	Regulatory	BIOFAB	36	-1	. . . attaatcatccggctcgtaggttgtgtgga
BBa_K3702028	BIOFAB Random Promoter apFAB279	Regulatory	BIOFAB	35	-1	. . . ctttaatcatcggctcgtataatgtgtgga
BBa_K3702029	BIOFAB Random Promoter apFAB314	Regulatory	BIOFAB	36	-1	. . . attaatcatccggctcctaagttgtgtgga
BBa_K3702030	BIOFAB Random Promoter apFAB281	Regulatory	BIOFAB	36	-1	. . . tttaatcatccggctcgtataatgtgtgga
BBa_K3702031	BIOFAB Random Promoter apFAB276	Regulatory	BIOFAB	35	-1	. . . tattaatcatcggctcgtataatgtgtgga
BBa_K3702032	BIOFAB Random Promoter apFAB312	Regulatory	BIOFAB	36	-1	. . . attaatcatccggctcttagtgtttgtgga
BBa_K3702033	BIOFAB Random Promoter apFAB273	Regulatory	BIOFAB	36	-1	. . . tttaatcatccggctcgtataatgtgtgga
BBa_K3702034	BIOFAB Random Promoter apFAB316	Regulatory	BIOFAB	36	-1	. . . attaatcatccggctcatatagtatgtgga
BBa_K3702035	BIOFAB Random Promoter apFAB282	Regulatory	BIOFAB	36	-1	. . . cttaatcatccggctcgtataatgtgtgga
BBa_K3702036	BIOFAB Random Promoter apFAB260	Regulatory	BIOFAB	35	-1	. . . tgttaatcatcggctcgtataatgtgtgga
BBa_K3702037	BIOFAB Random Promoter apFAB293	Regulatory	BIOFAB	36	-1	. . . attaatcatccggctcttaggttgtgtgga
BBa_K3702038	BIOFAB Random Promoter apFAB259	Regulatory	BIOFAB	36	-1	. . . cttaatcatccggctcgtataatgtgtgga
BBa_K3702039	BIOFAB Random Promoter apFAB284	Regulatory	BIOFAB	36	-1	. . . attaatcatccggctcataagttttgtgga
BBa_K3702040	BIOFAB Random Promoter apFAB285	Regulatory	BIOFAB	36	-1	. . . attaatcatccggctcctagcctctgtgga
BBa_K3702041	BIOFAB Random Promoter apFAB286	Regulatory	BIOFAB	36	-1	. . . attaatcatccggctcttagtttttgtgga
BBa_K3702042	BIOFAB Random Promoter apFAB257	Regulatory	BIOFAB	36	-1	. . . gttaatcatccggctcgtataatgtgtgga
BBa_K3702043	BIOFAB Random Promoter apFAB267	Regulatory	BIOFAB	36	-1	. . . attaatcatccggctcgtagggtctgtgga
BBa_K3702044	BIOFAB Random Promoter apFAB263	Regulatory	BIOFAB	36	-1	. . . gttaatcatccggctcgtataatgtgtgga
BBa_K3702045	BIOFAB Random Promoter apFAB262	Regulatory	BIOFAB	36	-1	. . . attaatcatccggctcgtataatgtgtgga
BBa_K3702046	BIOFAB Random Promoter apFAB265	Regulatory	BIOFAB	35	-1	. . . tattaatcatcggctcatccattatgtgga
BBa_K3702047	BIOFAB Random Promoter apFAB271	Regulatory	BIOFAB	36	-1	. . . attaatcatccggctcttagcgtgtgtgga
BBa_K3702048	BIOFAB Random Promoter apFAB278	Regulatory	BIOFAB	36	-1	. . . gttaatcatccggctcgtataatgtgtgga
BBa_K3702049	BIOFAB Random Promoter apFAB241	Regulatory	BIOFAB	35	-1	. . . attaatcatccggctcgtataatgtgtgga
BBa_K3702050	BIOFAB Random Promoter apFAB280	Regulatory	BIOFAB	36	-1	. . . attaatcatccggctcgtataatgtgtgga
BBa_K3702051	BIOFAB Random Promoter apFAB254	Regulatory	BIOFAB	36	-1	. . . attaatcatccggctcgtataatgtgtgga
BBa_K3702052	BIOFAB Random Promoter apFAB266	Regulatory	BIOFAB	35	-1	. . . aattaatcatcggctcttaggctatgtgga
BBa_K3702053	BIOFAB Random Promoter apFAB270	Regulatory	BIOFAB	35	-1	. . . aattaatcatcggctcataaagtgtgtgga
BBa_K3702054	BIOFAB Random Promoter apFAB287	Regulatory	BIOFAB	36	-1	. . . attaatcatccggctcctagggtttgtgga
BBa_K3702055	BIOFAB Random Promoter apFAB256	Regulatory	BIOFAB	36	-1	. . . attaatcatccggctcgtataatgtgtgga
BBa_K3702056	BIOFAB Random Promoter apFAB253	Regulatory	BIOFAB	36	-1	. . . gttaatcatccggctcgtataatgtgtgga
BBa_K3702057	BIOFAB Random Promoter apFAB264	Regulatory	BIOFAB	35	-1	. . . ctttaatcatcggctcgtataatgtgtgga
BBa_K3702058	BIOFAB Random Promoter apFAB337	Regulatory	BIOFAB	36	-1	. . . cttaatcatccggctcgtataatgtgtgga
BBa_K3702059	BIOFAB Random Promoter apFAB261	Regulatory	BIOFAB	36	-1	. . . cttaatcatccggctcgtataatgtgtgga
BBa_K3702060	BIOFAB Random Promoter apFAB272	Regulatory	BIOFAB	35	-1	. . . aattaatcatcggctcgtagagtttgtgga
BBa_K3702061	BIOFAB Random Promoter apFAB274	Regulatory	BIOFAB	36	-1	. . . tttaatcatccggctcgtataatgtgtgga
BBa_K3702062	BIOFAB Random Promoter apFAB258	Regulatory	BIOFAB	36	-1	. . . attaatcatccggctcctagtttctgtgga
BBa_K3702063	BIOFAB Random Promoter apFAB255	Regulatory	BIOFAB	35	-1	. . . aattaatcatcggctcgtataatgtgtgga
BBa_K3702064	BIOFAB Random Promoter apFAB268	Regulatory	BIOFAB	36	-1	. . . attaatcatccggctcatagcgtgtgtgga
BBa_K3702065	BIOFAB Random Promoter apFAB333	Regulatory	BIOFAB	36	-1	. . . cttaatcatccggctcgtataatgtgtgga
BBa_K3702066	BIOFAB Random Promoter apFAB326	Regulatory	BIOFAB	36	-1	. . . cttaatcatccggctcgtataatgtgtgga
BBa_K3702067	BIOFAB Random Promoter apFAB343	Regulatory	BIOFAB	36	-1	. . . attaatcatccggctcatagcgtctgtgga
BBa_K3702068	BIOFAB Random Promoter apFAB329	Regulatory	BIOFAB	36	-1	. . . cttaatcatccggctcgtatcatatgtgga
BBa_K3702069	BIOFAB Random Promoter apFAB332	Regulatory	BIOFAB	36	-1	. . . attaatcatccggctcgtataatgtgtgga
BBa_K3702070	BIOFAB Random Promoter apFAB252	Regulatory	BIOFAB	36	-1	. . . attaatcatccggctcatatgctttgtgga
BBa_K3702071	BIOFAB Random Promoter apFAB251	Regulatory	BIOFAB	36	-1	. . . attaatcatccggctcttaggttctgtgga
BBa_K3702072	BIOFAB Random Promoter apFAB226	Regulatory	BIOFAB	36	-1	. . . attaatcatccggctcgtataatctgtgga
BBa_K3702073	BIOFAB Random Promoter apFAB315	Regulatory	BIOFAB	36	-1	. . . cttaatcatccggctcgtataatgtgtgga
BBa_K3702074	BIOFAB Random Promoter apFAB335	Regulatory	BIOFAB	36	-1	. . . cttaatcatccggctcgtataatgtgtgga
BBa_K3702075	BIOFAB Random Promoter apFAB334	Regulatory	BIOFAB	36	-1	. . . gttaatcatccggctcgtataatgtgtgga
BBa_K3702076	BIOFAB Random Promoter apFAB319	Regulatory	BIOFAB	36	-1	. . . cttaatcatccggctcgtataatgtgtgga
BBa_K3702077	BIOFAB Random Promoter apFAB229	Regulatory	BIOFAB	36	-1	. . . tttaatcatccggctcgtataatgtgtgga
BBa_K3702078	BIOFAB Random Promoter apFAB228	Regulatory	BIOFAB	36	-1	. . . tttaatcatccggctcgtataatgtgtgga
BBa_K3702079	BIOFAB Random Promoter apFAB225	Regulatory	BIOFAB	36	-1	. . . gttaatcatccggctcctataatttgtgga
BBa_K3702080	BIOFAB Random Promoter apFAB224	Regulatory	BIOFAB	36	-1	. . . tttaatcatccggctcgtagagtgtgtgga
BBa_K3702081	BIOFAB Random Promoter apFAB324	Regulatory	BIOFAB	35	-1	. . . aattaatcatcggctcttaggctttgtgga
BBa_K3702082	BIOFAB Random Promoter apFAB230	Regulatory	BIOFAB	36	-1	. . . cttaatcatccggctcgtataatgtgtgga
BBa_K3702083	BIOFAB Random Promoter apFAB318	Regulatory	BIOFAB	36	-1	. . . attaatcatccggctcgtataatgtgtgga
BBa_K3702084	BIOFAB Random Promoter apFAB331	Regulatory	BIOFAB	36	-1	. . . cttaatcatccggctcggagactttgtgga
BBa_K3702085	BIOFAB Random Promoter apFAB304	Regulatory	BIOFAB	36	-1	. . . gttaatcatccggctcgtataatgtgtgga
BBa_K3702086	BIOFAB Random Promoter apFAB231	Regulatory	BIOFAB	36	-1	. . . tttaatcatccggctcgtataatgtgtgga
BBa_K3702087	BIOFAB Random Promoter apFAB227	Regulatory	BIOFAB	36	-1	. . . cttaatcatccggctcgtataatgtgtgga
BBa_K3702088	BIOFAB Random Promoter apFAB209	Regulatory	BIOFAB	36	-1	. . . gttaatcatccggctcgtataatgtgtgga
BBa_K3702089	BIOFAB Random Promoter apFAB202	Regulatory	BIOFAB	36	-1	. . . gttaatcatccggctcgtataatctgtgga
BBa_K3702090	BIOFAB Random Promoter apFAB212	Regulatory	BIOFAB	35	-1	. . . ttttaatcatcggctcgtataatgtgtgga
BBa_K3702091	BIOFAB Random Promoter apFAB211	Regulatory	BIOFAB	36	-1	. . . gttaatcatccggctcgtataatgtgtgga
BBa_K3702092	BIOFAB Random Promoter apFAB221	Regulatory	BIOFAB	36	-1	. . . attaatcatccggctcatagactgtgtgga
BBa_K3702093	BIOFAB Random Promoter apFAB205	Regulatory	BIOFAB	36	-1	. . . cttaatcatccggctcgtattatatgtgga
BBa_K3702094	BIOFAB Random Promoter apFAB201	Regulatory	BIOFAB	36	-1	. . . cttaatcatccggctcctatagtgtgtgga
BBa_K3702095	BIOFAB Random Promoter apFAB193	Regulatory	BIOFAB	36	-1	. . . cttaatcatccggctcgtataatgtgtgga
BBa_K3702096	BIOFAB Random Promoter apFAB203	Regulatory	BIOFAB	36	-1	. . . gttaatcatccggctcgtagtctgtgtgga
BBa_K3702097	BIOFAB Random Promoter apFAB200	Regulatory	BIOFAB	35	-1	. . . aattaatcatcggctcttagggtttgtgga
BBa_K3702098	BIOFAB Random Promoter apFAB207	Regulatory	BIOFAB	36	-1	. . . tttaatcatccggctcatatactttgtgga
BBa_K3702099	BIOFAB Random Promoter apFAB206	Regulatory	BIOFAB	36	-1	. . . tttaatcatccggctcgtaccctttgtgga
BBa_K3702101	BIOFAB Random Promoter apFAB208	Regulatory	BIOFAB	36	-1	. . . gttaatcatccggctcgtataatgtgtgga
BBa_K3702102	BIOFAB Random Promoter apFAB181	Regulatory	BIOFAB	36	-1	. . . gttaatcatccggctcgtaaactgtgtgga
BBa_K3702103	BIOFAB Random Promoter apFAB204	Regulatory	BIOFAB	36	-1	. . . attaatcatccggctcctagtgtatgtgga
BBa_K3702104	BIOFAB Random Promoter apFAB190	Regulatory	BIOFAB	35	-1	. . . cgttaatcatcggctcgtataatgtgtgga
BBa_K3702105	BIOFAB Random Promoter apFAB189	Regulatory	BIOFAB	35	-1	. . . ccttaatcatcggctcgtataatgtgtgga
BBa_K3702106	BIOFAB Random Promoter apFAB184	Regulatory	BIOFAB	36	-1	. . . attaatcatccggctcgtacgatgtgtgga
BBa_K3702107	BIOFAB Random Promoter apFAB215	Regulatory	BIOFAB	35	-1	. . . ggttaatcatcggctcgtataatgtgtgga
BBa_K3702108	BIOFAB Random Promoter apFAB168	Regulatory	BIOFAB	35	-1	. . . cctaatcatccggctcgtataatgtgtgga
BBa_K3702109	BIOFAB Random Promoter apFAB197	Regulatory	BIOFAB	35	-1	. . . aattaatcatcggctcttaggttttgtgga
BBa_K3702110	BIOFAB Random Promoter apFAB199	Regulatory	BIOFAB	35	-1	. . . attaatcatccggctcgtagtgtgtgtgga
BBa_K3702111	BIOFAB Random Promoter apFAB216	Regulatory	BIOFAB	36	-1	. . . gttaatcatccggctcgtataatgtgtgga
BBa_K3702112	BIOFAB Random Promoter apFAB180	Regulatory	BIOFAB	36	-1	. . . attaatcatccggctcgtattgtatgtgga
BBa_K3702113	BIOFAB Random Promoter apFAB187	Regulatory	BIOFAB	36	-1	. . . gttaatcatccggctcgtatagtctgtgga
BBa_K3702114	BIOFAB Random Promoter apFAB182	Regulatory	BIOFAB	36	-1	. . . tttaatcatccggctcttaacttgtgtgga
BBa_K3702115	BIOFAB Random Promoter apFAB186	Regulatory	BIOFAB	36	-1	. . . gttaatcatccggctcgtatgttctgtgga
BBa_K3702116	BIOFAB Random Promoter apFAB183	Regulatory	BIOFAB	36	-1	. . . attaatcatccggctcctaggttatgtgga
BBa_K3702117	BIOFAB Random Promoter apFAB195	Regulatory	BIOFAB	36	-1	. . . attaatcatccggctcggaaagaatgtgga
BBa_K3702118	BIOFAB Random Promoter apFAB167	Regulatory	BIOFAB	36	-1	. . . attaatcatccggctcataaaatttgtgga
BBa_K3702119	BIOFAB Random Promoter apFAB177	Regulatory	BIOFAB	36	-1	. . . cttaatcatccggctcaggtgtaatgtgga
BBa_K3702120	BIOFAB Random Promoter apFAB192	Regulatory	BIOFAB	36	-1	. . . cttaatcatccggctcgtataatgtgtgga
BBa_K3702121	BIOFAB Random Promoter apFAB220	Regulatory	BIOFAB	35	-1	. . . aattaatcatcggctcatatggtctgtgga
BBa_K3702122	BIOFAB Random Promoter apFAB161	Regulatory	BIOFAB	36	-1	. . . cttaatcatccggctcttagagtatgtgga
BBa_K3702123	BIOFAB Random Promoter apFAB160	Regulatory	BIOFAB	36	-1	. . . cttaatcatccggctcttatagtttgtgga
BBa_K3702124	BIOFAB Random Promoter apFAB162	Regulatory	BIOFAB	36	-1	. . . attaatcatccggctcgtagtctgtgtgga
BBa_K3702125	BIOFAB Random Promoter apFAB159	Regulatory	BIOFAB	36	-1	. . . gttaatcatccggctcctagcatgtgtgga
BBa_K3702126	BIOFAB Random Promoter apFAB164	Regulatory	BIOFAB	36	-1	. . . attaatcatccggctcttaccgtttgtgga
BBa_K3702127	BIOFAB Random Promoter apFAB166	Regulatory	BIOFAB	36	-1	. . . cttaatcatctggctcatagtttatgtgga
BBa_K3702128	BIOFAB Random Promoter apFAB157	Regulatory	BIOFAB	36	-1	. . . attaatcatccggctcatattttttgtgga
BBa_K3702129	BIOFAB Random Promoter apFAB217	Regulatory	BIOFAB	35	-1	. . . aattaatcatcggctcctagggtttgtgga
BBa_K3702130	BIOFAB Random Promoter apFAB156	Regulatory	BIOFAB	36	-1	. . . gttaatcatccggctcctagtttgtgtgga
BBa_K3702131	BIOFAB Random Promoter apFAB213	Regulatory	BIOFAB	36	-1	. . . gttaatcatccggctcgtataatgtgtgga
BBa_K3702132	BIOFAB Random Promoter apFAB325	Regulatory	BIOFAB	35	-1	. . . aattaatatccggctcgtagcgtctgtgga
BBa_K3702133	BIOFAB Random Promoter apFAB188	Regulatory	BIOFAB	35	-1	. . . ccttaatcatcggctcgtataatgtgtgga
BBa_K3702134	BIOFAB Random Promoter apFAB210	Regulatory	BIOFAB	35	-1	. . . cgttaatcatcggctcgtataatgtgtgga
BBa_K3702135	BIOFAB Random Promoter apFAB327	Regulatory	BIOFAB	36	-1	. . . tttaatcatccggctcctactctgtgtgga
BBa_K3702136	BIOFAB Random Promoter apFAB294	Regulatory	BIOFAB	36	-1	. . . gttaatcatccggctcataaaatttgtgga

Terminators Table

More...

Name	Description	Type	Created by	length	uses	seq
BBa_K3702161	BIOFAB Terminator apFAB376	Terminator	BIOFAB	34	-1	. . . aaaaaccccgcttcggcggggttttttcgc
BBa_K3702173	BIOFAB Terminator apFAB388	Terminator	BIOFAB	39	-1	. . . ccccgcccctgacagggcggggtttttttt
BBa_K3702137	BIOFAB Terminator apFAB352	Terminator	BIOFAB	86	-1	. . . gggggagagggaagtcatgaaaaaactaac
BBa_K3702138	BIOFAB Terminator apFAB353	Terminator	BIOFAB	50	-1	. . . atatttcgattgcatgtgcaattttttgca
BBa_K3702139	BIOFAB Terminator apFAB354	Terminator	BIOFAB	33	-1	. . . tcgcaaaaaaccccgctggggttttttcgc
BBa_K3702140	BIOFAB Terminator apFAB355	Terminator	BIOFAB	80	-1	. . . tgtctattatccctaagcccattttttgca
BBa_K3702141	BIOFAB Terminator apFAB356	Terminator	BIOFAB	121	-1	. . . tgcactaagcacataattgctcacagccaa
BBa_K3702142	BIOFAB Terminator apFAB357	Terminator	BIOFAB	52	-1	. . . gatacccagcccgcctaatcaatgcaaaca
BBa_K3702143	BIOFAB Terminator apFAB358	Terminator	BIOFAB	31	-1	. . . gcaaaaaaccccgctgcggggttttttcgc
BBa_K3702144	BIOFAB Terminator apFAB359	Terminator	BIOFAB	83	-1	. . . gggggagagggaagtcatgaaaaaactaac
BBa_K3702145	BIOFAB Terminator apFAB360	Terminator	BIOFAB	40	-1	. . . tgtctattatccctaagcccattttttgca
BBa_K3702146	BIOFAB Terminator apFAB361	Terminator	BIOFAB	105	-1	. . . cagccgtatgacaaggtcggcatcaggtgt
BBa_K3702147	BIOFAB Terminator apFAB362	Terminator	BIOFAB	80	-1	. . . cagccgcctgtcgcccgaaggccggtcggc
BBa_K3702148	BIOFAB Terminator apFAB363	Terminator	BIOFAB	91	-1	. . . gcgcggttgataacggttcagacaggttta
BBa_K3702149	BIOFAB Terminator apFAB364	Terminator	BIOFAB	102	-1	. . . cgataaagaagatttagcttcaaataaaac
BBa_K3702150	BIOFAB Terminator apFAB365	Terminator	BIOFAB	108	-1	. . . cagccgtatgacaaggtcggcatcaggtgt
BBa_K3702151	BIOFAB Terminator apFAB366	Terminator	BIOFAB	109	-1	. . . cagccgtatgacaaggtcggcatcaggtgt
BBa_K3702152	BIOFAB Terminator apFAB367	Terminator	BIOFAB	83	-1	. . . gaacaaaattagagaataacaatgcaaaca
BBa_K3702153	BIOFAB Terminator apFAB368	Terminator	BIOFAB	96	-1	. . . gcgcggttgataacggttcagacaggttta
BBa_K3702154	BIOFAB Terminator apFAB369	Terminator	BIOFAB	106	-1	. . . cagccgtatgacaaggtcggcatcaggtgt
BBa_K3702155	BIOFAB Terminator apFAB370	Terminator	BIOFAB	97	-1	. . . gcgcggttgataacggttcagacaggttta
BBa_K3702156	BIOFAB Terminator apFAB371	Terminator	BIOFAB	93	-1	. . . cccccgatgtggcgcagactgatttatcac
BBa_K3702157	BIOFAB Terminator apFAB372	Terminator	BIOFAB	91	-1	. . . gggggagagggaagtcatgaaaaaactaac
BBa_K3702158	BIOFAB Terminator apFAB373	Terminator	BIOFAB	84	-1	. . . attactcaacaggtaaggcgcgaggttttc
BBa_K3702159	BIOFAB Terminator apFAB374	Terminator	BIOFAB	104	-1	. . . ttgggtcagtcgtataaaggtcattacgga
BBa_K3702160	BIOFAB Terminator apFAB375	Terminator	BIOFAB	80	-1	. . . tcccgatcttaatgaatggccggaagtggt
BBa_K3702162	BIOFAB Terminator apFAB377	Terminator	BIOFAB	91	-1	. . . gggggagagggaagtcatgaaaaaactaac
BBa_K3702163	BIOFAB Terminator apFAB378	Terminator	BIOFAB	91	-1	. . . caagcagcagattacgcgcagaaaaaaagg
BBa_K3702164	BIOFAB Terminator apFAB379	Terminator	BIOFAB	85	-1	. . . gaacaaaattagagaataacaatgcaaaca
BBa_K3702165	BIOFAB Terminator apFAB380	Terminator	BIOFAB	85	-1	. . . gaacaaaattagagaataacaatgcaaaca
BBa_K3702166	BIOFAB Terminator apFAB381	Terminator	BIOFAB	90	-1	. . . ttccgggcattaaccctcactaacaggaga
BBa_K3702167	BIOFAB Terminator apFAB382	Terminator	BIOFAB	87	-1	. . . gaacaaaattagagaataacaatgcaaaca
BBa_K3702168	BIOFAB Terminator apFAB383	Terminator	BIOFAB	88	-1	. . . tttataaggagacactttatgtttaagaag
BBa_K3702169	BIOFAB Terminator apFAB384	Terminator	BIOFAB	91	-1	. . . atctgttgtttgtcggtgaacgctctcctg
BBa_K3702170	BIOFAB Terminator apFAB385	Terminator	BIOFAB	87	-1	. . . gaacaaaattagagaataacaatgcaaaca
BBa_K3702171	BIOFAB Terminator apFAB386	Terminator	BIOFAB	85	-1	. . . ggagattttcaacatgaaaaaattattatt
BBa_K3702172	BIOFAB Terminator apFAB387	Terminator	BIOFAB	91	-1	. . . atctgttgtttgtcggtgaacgctctcctg
BBa_K3702174	BIOFAB Terminator apFAB389	Terminator	BIOFAB	91	-1	. . . atctgttgtttgtcggtgaacactctcccg
BBa_K3702175	BIOFAB Terminator apFAB390	Terminator	BIOFAB	89	-1	. . . gaccttaaaaacataaccgaggagcagaca
BBa_K3702176	BIOFAB Terminator apFAB391	Terminator	BIOFAB	82	-1	. . . tttggaggggcagaaagatgaatgactgtc