Part:BBa_J23103:Experience

This experience page is provided so that any user may enter their experience using this part.
Please enter how you used this part and how it worked out.

Applications of BBa_J23103

Use of this promoter by team Glasgow 2014

We found this promoter is actually identical in sequence to BBa_J23112

BBa_J23116, BBa_J23106, BBa_J23103, and BBa_J23112 were used to express motA and motB together in our composite biobricks:
BBa_ K1463773, BBa_ K1463772, BBa_ K1463770, and BBa_ K1463771 respectively.
These composite biobricks were used to complement the swimming defect of a motA E. coli mutant.
We found that swimming was restored in the following order:
BBa_J23116 > BBa_J23106 > BBa_J23103 = BBa_J23112.
Examination of the sequences of BBa_J23103 and BBa_J23112 showed that they are identical, despite showing different levels of RFP expression in their initial characterisation!

>BBa_J23103 Part-only sequence (35 bp) ctgatagctagctcagtcctagggattatgctagc

>BBa_J23112 Part-only sequence (35 bp) ctgatagctagctcagtcctagggattatgctagc

Evaluation of Anderson promoter J23103 in B. subtilis by iGEM-Team LMU-Munich 2012

This Anderson promoter was evaluated without fused RFP with the lux operon as a reporter in B. subtilis. See the new BioBrick BBa_K823007 without RFP and have a look at the [http://2012.igem.org/Team:LMU-Munich/Data/Anderson Data] from the evaluation in B. subtilis.

User Reviews

UNIQd4642574e0161f52-partinfo-00000000-QINU

••••• iGEM HKU 2011

To start characterizing the promoters, we have performed the red florescence intensity measurements for our selected plasmid in the E.Coli MG1655 strain. The data collected is shown below. It is found that promoter J23106 can lead to a higher expression since the fluorescence intensity per OD600 is the highest, while J23103, J23109, J23116 have relative low expression and fluorescence. As our selected promoters have different strength, thus our team is able to use them to fine tune the protein expression. mRFP fluorescence intensity under different promoters UNIQd4642574e0161f52-partinfo-00000002-QINU ••••• University of Texas at Austin iGEM 2019 UT Austin iGEM 2019: Characterization of metabolic burden of the Anderson Series Description The 2019 UT Austin iGEM team transformed the Anderson Series promoters into our 'burden monitor' DH10B strain of E. coli that contains constitutively expressed GFP in the genome. By doing so, the relative burden (percent reduction in growth rate) of each part was determined. Our results showed a range of growth rate reductions due to ribosomal reallocation from the genome of the host cell, towards the genetic circuit. The graph below demonstrates a positive correlation between relative promoter strength and metabolic burden; parts with stronger promoters express less GFP and have a reduced growth rate than parts with weaker promoters. The regression line for the graph below was constructed by measuring the burden of 5 parts that were created by the 2019 UT Austin iGEM team containing Anderson Series promoters J23104 and J23110, an RBS of varying strength, and a BFP reporter. For more information on characterization of these parts through burden monitoring and evolutionary stability experiments, visit our team’s wiki page: [1]