Robert E. Campbell started with Discosoma RFP (DsRed) and evolved a faster folding, monomeric variant. See paper listed in source. Codon optimized for expression in bacteria (?? DE)
iGEM11_Uppsala-Sweden: Expression of chromoproteins. The images above show E coli constitutively expressing amilCP BBa_K592009 (blue), amilGFP BBa_K592010 (yellow) and RFP BBa_E1010 (red).
Peking iGEM 2016 has fused this part with triple spytag. The fused protein is participate in Peking’s polymer network. By adding this protein, the whole polymer network become visible in most conditions. If you want to learn more about Peking’s polymer network and the role of mRFP in this network, please click here https://parts.igem.org/Part:BBa_K1989004".
Contribution
Group: Hong Kong-CUHK iGEM 2017
Author: Yuet Ching Lin
Summary: We measured the fluorescent signal of mRFP in buffers with different pH.
Documentation:
Charaterization of mRFP pH stabillity:
We grew C41 bacteria with parts BBa_J61002 in 2XYT for 24 hours. After purifying the mRFP by Ion Exchange Chromatography and Hydrophobic Interaction Chromatography, we measured the fluoresece (ex ,em ) of purified mRFP, which is diluted to 10µg/100µl (total 200µl) in triplicates, into different buffers (ranges from pH2 to pH12; Volume of mRFP:buffer = 1:1.8). To facilitate reproducibility of the experiment, we correlated the relative fluorescent intensity to an absolute fluorophore concentration by referring it to a standard curve of the fluorophores(Rhodamine) using the interlab study protocol. The result shows that the stability drops dramatically in pH condition below 6 and relatively stable in pH 6-10.
Fig.1 Vary pH attributed to different fluorescent intensity of RFP.
Table 1 Plate reader setting of fluorescent measurement
Measurement Type
Fluorescence
Microplate name</td>
COSTAR 96
Scan mode
orbital averaging
Scan diameter [nm]
3
Excitation
550-20
Emission
605-40
Dichronic filter
auto 572.5
Gain
500
Focal height [nm]
9
|};
Contribution2
Group: iGEM17_CSMU_NCHU_Taiwan 2017
Author: SHAO-CHI LO
Summary: We add a His Tag at the end. Therefore, a fusion protein with this part may have red color and the ability to be purified easily. For more, we use the IDT Codon Optimization Tool(http://sg.idtdna.com/CodonOpt) to optimize the sequence and make it more suit in E.coli K12
Documentation:
Nucleotide sequence in RFC 10: (underlined part encodes the protein) ATGGCTTCC ... ACCGGTGCTTAATAACGCTGATAGTGCTAGTGTAGATCGC ORF from nucleotide position 1 to 675 (excluding stop-codon)
Amino acid sequence: (RFC 25 scars in shown in bold, other sequence features underlined; both given below)
The BioBrick-AutoAnnotator was created by TU-Munich 2013 iGEM team. For more information please see the documentation. If you have any questions, comments or suggestions, please leave us a comment.
1 Registry Star
