Software error:
syntax error at /websites/parts.igem.org/cgi/lib/Range.pm line 230, near ""<BR>$group_name, $year, $team_name, $team_digits, $range_name, $range_prefix")" Compilation failed in require at /websites/parts.igem.org/cgi/lib/Part.pm line 16. BEGIN failed--compilation aborted at /websites/parts.igem.org/cgi/lib/Part.pm line 16. Compilation failed in require at /websites/parts.igem.org/cgi/lib/IconBar.pm line 10. BEGIN failed--compilation aborted at /websites/parts.igem.org/cgi/lib/IconBar.pm line 10. Compilation failed in require at /websites/parts.igem.org/cgi/lib/BBWeb.pm line 9. BEGIN failed--compilation aborted at /websites/parts.igem.org/cgi/lib/BBWeb.pm line 9. Compilation failed in require at /websites/parts.igem.org/cgi/lib/WrapPart.pm line 8. BEGIN failed--compilation aborted at /websites/parts.igem.org/cgi/lib/WrapPart.pm line 8. Compilation failed in require at /websites/parts.igem.org/cgi/extensions/wiki_header_hook.cgi line 9. BEGIN failed--compilation aborted at /websites/parts.igem.org/cgi/extensions/wiki_header_hook.cgi line 9.
For help, please send mail to this site's webmaster, giving this error message and the time and date of the error.
Status: 500 Content-type: text/html
Software error:
syntax error at /websites/parts.igem.org/cgi/lib/Range.pm line 230, near ""<BR>$group_name, $year, $team_name, $team_digits, $range_name, $range_prefix")" Compilation failed in require at /websites/parts.igem.org/cgi/lib/Part.pm line 16. BEGIN failed--compilation aborted at /websites/parts.igem.org/cgi/lib/Part.pm line 16. Compilation failed in require at /websites/parts.igem.org/cgi/partsdb/putout.cgi line 8. BEGIN failed--compilation aborted at /websites/parts.igem.org/cgi/partsdb/putout.cgi line 8.
For help, please send mail to this site's webmaster, giving this error message and the time and date of the error.
Synthetic pseudoknot that induces -1 frameshift during translation. Part has flanking RFC 25 prefix and suffix upstream and downstream.
RFC 25 prefix 5' GAATTCGCGGCCGCTTCTAGATGGCCGGC 3'
RFC 25 suffix 5' ACCGGTTAATACTAGTAGCGGCCGCTGCAG 3'
Assembly with this part should be done using the RFC 25 assembly strategy (which creates the following scar: 5' [part A] ACCGGC [part B] 3'). Assembling using RFC 23 (Silver standard) creates a stop codon in the -1 frame of the scar sequence (5' [part A] ACTAGA [part B] 3').
Sequence and Features
Status: 500
Content-type: text/html
Software error:
syntax error at /websites/parts.igem.org/cgi/lib/Range.pm line 230, near ""<BR>$group_name, $year, $team_name, $team_digits, $range_name, $range_prefix")" Compilation failed in require at /websites/parts.igem.org/cgi/lib/Part.pm line 16. BEGIN failed--compilation aborted at /websites/parts.igem.org/cgi/lib/Part.pm line 16. Compilation failed in require at /websites/parts.igem.org/cgi/partsdb/putout.cgi line 8. BEGIN failed--compilation aborted at /websites/parts.igem.org/cgi/partsdb/putout.cgi line 8.
For help, please send mail to this site's webmaster, giving this error message and the time and date of the error.
Software error:
syntax error at /websites/parts.igem.org/cgi/lib/Range.pm line 230, near ""<BR>$group_name, $year, $team_name, $team_digits, $range_name, $range_prefix")" Compilation failed in require at /websites/parts.igem.org/cgi/lib/Part.pm line 16. BEGIN failed--compilation aborted at /websites/parts.igem.org/cgi/lib/Part.pm line 16. Compilation failed in require at /websites/parts.igem.org/cgi/extensions/part_box.cgi line 9. BEGIN failed--compilation aborted at /websites/parts.igem.org/cgi/extensions/part_box.cgi line 9.
For help, please send mail to this site's webmaster, giving this error message and the time and date of the error.