Difference between revisions of "Part:BBa E1010:Experience"

Revision as of 03:33, 28 October 2010

This experience page is provided so that any user may enter their experience using this part.
Please enter how you used this part and how it worked out.

RANDOM SEQUENCE FOUND WITHIN PART

CGCTGATAGTGCTAGTGTAGATCGC is found after the RFP stop codon and before the BioBricks suffix. Should not affect transcription or translation of RFP, but good to keep note of it especially in analyzing sequencing results. (KP of siGEM)

Applications of BBa_E1010

User Reviews

UNIQd385312314675c06-partinfo-00000000-QINU

•••

DTU_igem_2010

Characterization of RFP BBa_E1010
We have characterized RFP BBa_E1010 in two different chassis to test the compatibility and the possible range of expressions before limitations in the cell metabolism.

Method
We have made constructs with a synthetic promoter library (SPL) in front of the E1010, by using BBa_I03507 and the psB3T5. For information on design of an SPL compatible with the BB standard see [http://bbf.openwetware.org/RFC.html#BBF_RFC_63:_DTU_Synthetic_Promoter_Library_Standard BBF RFC63]. We have benchmarked the relative promoter strength range achieved from the SPL to the standard promoter BBa_J23101, by calculating the relative promoter strength in vivo as suggested in [http://bbf.openwetware.org/RFC.html#BBF_RFC_19:_Measuring_the_Activity_of_BioBrick.E2.84.A2_Promoters_Using_an_In_Vivo_Reference_Standard BBF RFC 19]. For further explanation on methods see our [http://2010.igem.org/Team:DTU-Denmark iGEM_DTU_2010 wiki].

Results
We show that the RFP E1010 can be expressed with the following results

In XL1blue with an RPU range form 0 to at least 1,13 RPU.
In DHA5&alpha with an RPU range from 0 to 1,35 RPU.

Graph2 XL1BLUE illustrates the variation in promoter strengths of the SPL mapped against the reference promoters. PM corresponds to BBa_J23101, PS corresponds to BBa_J23100 and PW corresponds to BBa_J23116.

Graph3 XL1BLUEillustrates the specific activities of the SPL promoters ranked together with the reference promoters.

Graph4 DH5aillustrates the variation in promoter strengths of the SPL mapped against the reference promoters. PM corresponds to BBa_J23101, PS corresponds to BBa_J23100 and PW corresponds to BBa_J23116.

Graph5 DH5a illustrates the specific activities of the SPL promoters ranked against the reference promoters.

**Table 1** shows the specific activities and RPUs calculated for all the SPL constructs run in BioLector in XL1-blue
Construct	Specific Activity	RPU
BBa_J23101	0.0795	1.00
SPL_RFP01	0.00578	0.0727
SPL_RFP02	0.0418	0.526
SPL_RFP03	0.0612	0.770
SPL_RFP04	-0.00027	-0.00340
SPL_RFP05	0.0418	0.526
SPL_RFP06	0.0856	1.08
SPL_RFP07	0.0134	0.168
SPL_RFP08	0.0534	0.672
SPL_RFP09	0.0638	0.803
SPL_RFP10	0.00260	0.0327
SPL_RFP11	0.0900	1.13
SPL_RFP12	0.0600	0.755
SPL_RFP13	0.0754	0.949
SPL_RFP14	0.00795	0.100
SPL_RFP16	0.00959	0.121

**Table 2** shows the specific activities and RPUs calculated for all the SPL constructs run in BioLector in DH5&alpha
Construct	Specific Activity	RPU
BBa_J23101	0.0712	1.00
SPL_RFP-D01	0.0715	1.00
SPL_RFP-D02	0.0959	1.35
SPL_RFPD-03	0.0781	1.10
SPL_RFPD-04	0.0531	0.746
SPL_RFPD-05	0.0732	1.03
SPL_RFPD-06	0.0552	0.775
SPL_RFPD-07	0.0358	0.503
SPL_RFPD-08	0.0668	0.938
SPL_RFPD-09	0.0254	0.357
SPL_RFPD-10	0.0165	0.231
SPL_RFPD-11	-0.00284	-0.399
SPL_RFPD-12	0.00276	0.0387
SPL_RFPD-13	0.0776	1.09
SPL_RFPD-14	0.0018	0.0253
SPL_RFPD-15	0.00302	0.0424

Conclusions and Discussion

;

Antiquity

This review comes from the old result system and indicates that this part did not work in some test.

No review score entered. Nkessler

We successfully used this part for a read out system, e.g. in BBa_K389016. Additionally we compared it with a luciferase: BBa_K389004.

UNIQd385312314675c06-partinfo-00000006-QINU

@@ Line 35: / Line 35: @@
 '''Results'''<br>
-We show that the RFP E1010 can be expressed with the following results:
+We show that the RFP E1010 can be expressed with the following results
- * In XL1blue with an RPU range form 0 to at least 1,13 RPU.
+*In XL1blue with an RPU range form 0 to at least 1,13 RPU.
- * In DHA5&alpha with an RPU range from 0 to 1,35 RPU.
+*In DHA5&alpha with an RPU range from 0 to 1,35 RPU.
-[[Image:Graph2 XL1BLUE.png|center|thumb|400px|]]
+[[Image:Graph2 XL1BLUE.png|center|thumb|400px|'''Graph2 XL1BLUE''' illustrates the variation in promoter strengths of the SPL mapped against the reference promoters. PM corresponds to BBa_J23101, PS corresponds to BBa_J23100 and PW corresponds to BBa_J23116.]]
-[[Image:Graph3 XL1BLUE.png|center|thumb|400px|]]
-[[Image:Graph4 DH5a.png|center|thumb|400px|]]
+[[Image:Graph3 XL1BLUE.png|center|thumb|400px|'''Graph3 XL1BLUE'''illustrates the specific activities of the SPL promoters ranked together with the reference promoters.]]
-[[Image:Graph5 DH5a.png|center|thumb|400px|]]
+[[Image:Graph4 DH5a.png|center|thumb|400px|'''Graph4 DH5a'''illustrates the variation in promoter strengths of the SPL mapped against the reference promoters. PM corresponds to BBa_J23101, PS corresponds to BBa_J23100 and PW corresponds to BBa_J23116.]]
+[[Image:Graph5 DH5a.png|center|thumb|400px|'''Graph5 DH5a''' illustrates the specific activities of the SPL promoters ranked against the reference promoters.]]
 <table cellpadding="2" border="1px" cellspacing="0" align="center" width="70%">
-<caption><p align="justify"><b>Table 1</b></p></caption>
+<caption><p align="justify"><b>Table 1</b> shows the specific activities and RPUs calculated for all the SPL constructs run in BioLector in XL1-blue</p></caption>
-<thead>
 <td align="center"><b>Construct</b></td><td align="center"><b>Specific Activity</b></td><td align="center"><b>RPU</b></td>
-</thead></tr>
 <tr>
 <td align="left">BBa_J23101</td><td align="right">0.0795</td><td align="right">1.00</td>
@@ Line 101: / Line 102: @@
 <table cellpadding="2" border="1px" cellspacing="0" align="center" width="70%">
-<caption><p align="justify"><b>Table 2 shows the specific activities and RPUs calculated for all the SPL constructs run in the second set of measurements in BioLector</b></p></caption>
+<caption><p align="justify"><b>Table 2</b> shows the specific activities and RPUs calculated for all the SPL constructs run in BioLector in DH5&alpha</p></caption>
-<thead>
 <td align="center"><b>Construct</b></td><td align="center"><b>Specific Activity</b></td><td align="center"><b>RPU</b></td>
-</thead></tr>
 <tr>
 <td align="left">BBa_J23101</td><td align="right">0.0712</td><td align="right">1.00</td>