Difference between revisions of "Part:BBa K371001:Design"

Revision as of 05:13, 27 October 2010

pduAB(Propanediol utilization gene A+B)[RBS+pduA+RBS+pduB]

Design Notes

In the previous literature，most of research work on pdu BMC(or pdu MCP) focus on Citrobacter Freundii and Salmonella enterica. Taking all of the factors together, we choose Citrobacter Freundii as the orgin of gene in our project. Because the whole genome of Citrobacter Freundii has not been decoded yet, we use the reference sequence sent to NCBI by Martin J.Warren group(GenBank: AM498294.1).By seraching the restriction enzyme site in pduAB(5525-6378), we found a PstI site inside pduA and a PstI site inside pduB. And in order to make the part Compatiblee with the BBF RFC53(A noval BioBrick assembly standard designed to facilitate protein fusion) for the following experiment. We also search the EarI, SacI ,SapI and BglII site inside pduAB. Luckily, none of these was found in pduAB.

We got the Citrobacter Freundii from NBRC(NBRC NO.12681). We isolate the whole genome of Citrobacter Freundii. Then we use this genoe as template and mutate the PstI site by over lapping PCR. Here is a rough illustration of our mutation workflow.

Six primer used in mutation PCR:

forward primer 1

5'-GTTT TCTAGAG AACCCAGGCGAGGTCTTTATGCAAC AAGAAGCGTTAGGAATGGTAGAA-3'

forward primer 2

5'-AAGAAGCGTTAGGAATGGTAGAA ACCAAAGGCTTGACAGCAGCCATA-3'

reverse primer 3

5'-CTCCGTTAAACTACAGCTTTTCTCTGCCATA-3'

forward primer 4

5'-TATGGCAGAGAAAAGCTGTAGTTTAACGGAG-3'

reverse primer 5'

5'-GTTT CTGCAGCGGCCGCTACTAGTA TCAGATGTAGGACGGACGAT-3'

The sequence results of pduAB are different from the sequence we found on Genebank. Some silent mutation locate in the sequence with no special spacial rule. We suspect that the strain we used is not same with the papar, maybe even belong to different strain of Citrobacter Freundii. However the proterin sequence alignment between the result of Martin J.Warren group, the proterin sequence of pduAB in Salmonella enterica and ours shows that the 'mutation' locate in the nonconserved site. Thus we decide to continue our experement with the gene pduAB.

Source

pduAB come from Citrobacter Freundii genome(NBRC NO.12681)

References