Difference between revisions of "Part:BBa K330000:Design"
(→Source) |
(→Design Notes) |
||
| Line 9: | Line 9: | ||
In order to prepare a ready-to-use FLAG-tag which can be easily added to other BioBrick™ Standard Biological Parts (for separation, recognition, etc.), a FLAG-tag encoding sequence flanked by standard BioBrick™ prefix (EcoRI, XbaI) and suffix (SpeI, PstI) is designed and ligated into standard DNA-shipping plasmid backbone pSB1C3. The DNA sequence of the FLAG-tag is as follows: 5’ gactacaaggatgacgacgacaag 3’; while the corresponding peptide sequence would be as follow: N-DYKDDDDK-C. | In order to prepare a ready-to-use FLAG-tag which can be easily added to other BioBrick™ Standard Biological Parts (for separation, recognition, etc.), a FLAG-tag encoding sequence flanked by standard BioBrick™ prefix (EcoRI, XbaI) and suffix (SpeI, PstI) is designed and ligated into standard DNA-shipping plasmid backbone pSB1C3. The DNA sequence of the FLAG-tag is as follows: 5’ gactacaaggatgacgacgacaag 3’; while the corresponding peptide sequence would be as follow: N-DYKDDDDK-C. | ||
| − | FLAG-tag is a polypeptide protein tag commonly used in molecular biology, particularly recombinant DNA technology. It can be tagged to the N-terminal or C-terminal of a protein coding sequence; it can also be added between two domains of a chimeric protein, giving that that the insertion of FLAG-tag will not affect the expected function of the polypeptide. FLAG-tag is used in affinity chromatography to separate or detect recombinant, overexpressed protein from wild-type protein; it can also be used in cellular localization studies by immunofluorescence or detection by SDS-PAGE protein electrophoresis. | + | FLAG-tag is a polypeptide protein tag commonly used in molecular biology, particularly recombinant DNA technology. It can be tagged to the N-terminal or C-terminal of a protein coding sequence; it can also be added between two domains of a chimeric protein, giving that that the insertion of FLAG-tag will not affect the expected function of the polypeptide (one of iGEM10_HKUST project constructs: signal peptide - flagtag - DD13-RNAIII inhibiting peptide. See details at http://2010.igem.org/Team:HKUST/Project/Experiment_Design#5). FLAG-tag is used in affinity chromatography to separate or detect recombinant, overexpressed protein from wild-type protein; it can also be used in cellular localization studies by immunofluorescence or detection by SDS-PAGE protein electrophoresis. |
===Source=== | ===Source=== | ||
Revision as of 07:54, 23 October 2010
Protein Tag: FLAG-tag
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21COMPATIBLE WITH RFC[21]
- 23COMPATIBLE WITH RFC[23]
- 25COMPATIBLE WITH RFC[25]
- 1000COMPATIBLE WITH RFC[1000]
Design Notes
In order to prepare a ready-to-use FLAG-tag which can be easily added to other BioBrick™ Standard Biological Parts (for separation, recognition, etc.), a FLAG-tag encoding sequence flanked by standard BioBrick™ prefix (EcoRI, XbaI) and suffix (SpeI, PstI) is designed and ligated into standard DNA-shipping plasmid backbone pSB1C3. The DNA sequence of the FLAG-tag is as follows: 5’ gactacaaggatgacgacgacaag 3’; while the corresponding peptide sequence would be as follow: N-DYKDDDDK-C.
FLAG-tag is a polypeptide protein tag commonly used in molecular biology, particularly recombinant DNA technology. It can be tagged to the N-terminal or C-terminal of a protein coding sequence; it can also be added between two domains of a chimeric protein, giving that that the insertion of FLAG-tag will not affect the expected function of the polypeptide (one of iGEM10_HKUST project constructs: signal peptide - flagtag - DD13-RNAIII inhibiting peptide. See details at http://2010.igem.org/Team:HKUST/Project/Experiment_Design#5). FLAG-tag is used in affinity chromatography to separate or detect recombinant, overexpressed protein from wild-type protein; it can also be used in cellular localization studies by immunofluorescence or detection by SDS-PAGE protein electrophoresis.
Source
aaaaaa