Difference between revisions of "Part:BBa K358019:Experience"
(→Applications of BBa_K358019) |
(→Applications of BBa_K358019) |
||
Line 28: | Line 28: | ||
Culture condition: | Culture condition: | ||
− | We also performed some experiences at 37C culture condition. However, in a few experiment, unexpected mutations on lactose promoter had occurred and the promoter wouldn't work in the end. We done the sequencing on this sample ( | + | We also performed some experiences at 37C culture condition. However, in a few experiment, unexpected mutations on lactose promoter had occurred and the promoter wouldn't work in the end. We done the sequencing on this sample. |
+ | |||
+ | |||
+ | BBa_R0011: aattgtgagcggataacaattgacattgtgagcggataacaagatactgagcaca | ||
+ | |||
+ | Sample (mutation occurred): aattgtgagcggataacaagatactgagcaca | ||
===User Reviews=== | ===User Reviews=== |
Revision as of 22:18, 19 October 2010
This experience page is provided so that any user may enter their experience using this part.
Please enter
how you used this part and how it worked out.
Applications of BBa_K358019
Using this part, we checked the function of SRRz gene.
Firstly, we constructed this part on low copy plasmid, pSB4K5, and transformed into KRX. It is necessary to repress the lactose promoter and avoid the disadvantage of cell lysis.
Secondly, we cultured samples on M9-Km 30C/overnight.
Experiment 1:
Then, diluted the sample and added IPTG as the inducer. We measured A550 at each time.
Experiment 2:
We added IPTG, not dilute the sample. We measured A550 at each time.
Finally,
Culture condition:
We also performed some experiences at 37C culture condition. However, in a few experiment, unexpected mutations on lactose promoter had occurred and the promoter wouldn't work in the end. We done the sequencing on this sample.
BBa_R0011: aattgtgagcggataacaattgacattgtgagcggataacaagatactgagcaca
Sample (mutation occurred): aattgtgagcggataacaagatactgagcaca
User Reviews
UNIQ1e7081f34b46ea01-partinfo-00000000-QINU UNIQ1e7081f34b46ea01-partinfo-00000001-QINU