Difference between revisions of "Part:BBa K411001:Design"

Latest revision as of 08:43, 18 October 2010

Theophylline-inducible Riboswitch

Assembly Compatibility:

This riboswitch has the following characteristics:

The inducer (Theophylline) cannot metabolize in E. coli.
Both the inducer (Theophylline) and the riboswitch itself does not naturally occur in E. coli .
It did not originally have EcoRI, XbaI, SpeI, and PstI cutting sites, so no point mutations were needed.

See [http://2010.igem.org/Team:NYMU-Taipei NYMU-Taipei's Design page]

Synthesized directly from two primers:

forward primer : 5' - gaattcgcggccgcttctagag ggtgataccagcatcgtcttgatgcccttggcag - 3'
reverse primer : 5' - ctgcagcggccgctactagta cttgttgtcttgcagcggggtgctgccaagggcatcaagac - 3'

@@ Line 6: / Line 6: @@
 ===Design Notes===
-We want to choose a kind of riboswitch which has the following characteristics:
+This riboswitch has the following characteristics:
-The inducer cannot metabolize in E. coli.
+* The inducer (Theophylline) cannot metabolize in ''E. coli''.
-It does not exist in naturally occurring E. coli
+* Both the inducer (Theophylline) and the riboswitch itself does not naturally occur in ''E. coli ''.
-It does not have EcoRI,X,S, or PstI cutting site
+* It did not originally have EcoRI, XbaI, SpeI, and PstI cutting sites, so no point mutations were needed.
+See [http://2010.igem.org/Team:NYMU-Taipei NYMU-Taipei's Design page]
 ===Source===