Difference between revisions of "Part:BBa K249005"
Line 1: | Line 1: | ||
− | |||
__NOTOC__ | __NOTOC__ | ||
<partinfo>BBa_K249005 short</partinfo> | <partinfo>BBa_K249005 short</partinfo> | ||
Line 11: | Line 10: | ||
<span class='h3bb'>Sequence and Features</span> | <span class='h3bb'>Sequence and Features</span> | ||
<partinfo>BBa_K249005 SequenceAndFeatures</partinfo> | <partinfo>BBa_K249005 SequenceAndFeatures</partinfo> | ||
+ | |||
+ | |||
+ | This part was designed as a plasmid backbone to allow for easy attachment of a C-terminal Arginine TAg to a gene of choice for localization into the lumazine Synthase microcompartment. | ||
+ | |||
+ | This part was shown to work vis the sequencing information that we received. | ||
+ | |||
+ | pSB - C-terminus | ||
+ | >lcl|20071 | ||
+ | |||
+ | Length=30 | ||
+ | Score = 60.0 bits (30), Expect = 1e-15 | ||
+ | Identities = 30/30 (100%), Gaps = 0/30 (0%) | ||
+ | Strand=Plus/Plus | ||
+ | |||
+ | Query 12 (the plasmid sent in) | ||
+ | CGCCGCCGCCGCCGCCGCCGCCGCCGCTAA 41 | ||
+ | |||
+ | Sbjct 1 (the sequence expected) | ||
+ | CGCCGCCGCCGCCGCCGCCGCCGCCGCTAA 30 | ||
+ | |||
+ | We fused a YFP gene with a C-terminal BioFusion standar suffix to this gene | ||
+ | |||
+ | C-terminal EYFP-dT | ||
+ | Score = 19.9 bits (10), Expect = 0.80 | ||
+ | Identities = 10/10 (100%), Gaps = 0/10 (0%) | ||
+ | |||
+ | Strand=Plus/Plus | ||
+ | |||
+ | Query 659 (the plasmid sent in) | ||
+ | GAAGTTCATC 668 | ||
+ | |||
+ | Sbjct 135 (the sequence expected) | ||
+ | GAAGTTCATC 144 | ||
+ | |||
+ | |||
+ | Query 714 ACAGCCACA 722 | ||
+ | |||
+ | Sbjct 440 ACAGCCACA 448 | ||
+ | |||
+ | |||
+ | The part was sequenced and showed some gaps due to low resolution of the sequencing data. However, it does show that the YFP gene is present, as is the C-terminal Arginine tag. Theses are simply examples of positive hits that came back, although there are many more that are present. In all there were 10 gaps in the sequence, all of which corresponded to N nucleotides in the sequencing information we received. | ||
+ | |||
Revision as of 15:02, 31 October 2009
C-terminal Arginine Fusion Vector
pSB1A3 with an C-terminal Arginine tag. This particular plasmid utilizes the BioFusion (aka Silver Lab) Standard for BioBrick assembly. Adds 10 Arginine residues to the C-terminus of a Protein (Includes Stop Codon)
Sequence and Features
- 10INCOMPATIBLE WITH RFC[10]Plasmid lacks a prefix.
Plasmid lacks a suffix. - 12INCOMPATIBLE WITH RFC[12]Plasmid lacks a prefix.
Plasmid lacks a suffix. - 21INCOMPATIBLE WITH RFC[21]Plasmid lacks a prefix.
Plasmid lacks a suffix. - 23INCOMPATIBLE WITH RFC[23]Plasmid lacks a prefix.
Plasmid lacks a suffix. - 25INCOMPATIBLE WITH RFC[25]Plasmid lacks a prefix.
Plasmid lacks a suffix. - 1000INCOMPATIBLE WITH RFC[1000]Plasmid lacks a prefix.
Plasmid lacks a suffix.
This part was designed as a plasmid backbone to allow for easy attachment of a C-terminal Arginine TAg to a gene of choice for localization into the lumazine Synthase microcompartment.
This part was shown to work vis the sequencing information that we received.
pSB - C-terminus >lcl|20071
Length=30 Score = 60.0 bits (30), Expect = 1e-15 Identities = 30/30 (100%), Gaps = 0/30 (0%) Strand=Plus/Plus
Query 12 (the plasmid sent in) CGCCGCCGCCGCCGCCGCCGCCGCCGCTAA 41
Sbjct 1 (the sequence expected) CGCCGCCGCCGCCGCCGCCGCCGCCGCTAA 30
We fused a YFP gene with a C-terminal BioFusion standar suffix to this gene
C-terminal EYFP-dT Score = 19.9 bits (10), Expect = 0.80 Identities = 10/10 (100%), Gaps = 0/10 (0%)
Strand=Plus/Plus
Query 659 (the plasmid sent in) GAAGTTCATC 668
Sbjct 135 (the sequence expected) GAAGTTCATC 144
Query 714 ACAGCCACA 722
Sbjct 440 ACAGCCACA 448
The part was sequenced and showed some gaps due to low resolution of the sequencing data. However, it does show that the YFP gene is present, as is the C-terminal Arginine tag. Theses are simply examples of positive hits that came back, although there are many more that are present. In all there were 10 gaps in the sequence, all of which corresponded to N nucleotides in the sequencing information we received.