Difference between revisions of "Part:BBa K197012:Design"
JCAnderson (Talk | contribs) (→Design Notes) |
|||
Line 1: | Line 1: | ||
− | |||
__NOTOC__ | __NOTOC__ | ||
<partinfo>BBa_K197012 short</partinfo> | <partinfo>BBa_K197012 short</partinfo> | ||
Line 7: | Line 6: | ||
===Design Notes=== | ===Design Notes=== | ||
− | + | This part is in BglBricks Standard. It is flanked by BamHI and BglII sites instead of XbaI and SpeI. More information about the BglBricks Standard is available at: | |
− | + | ||
+ | [http://openwetware.org/wiki/Template:AndersonLab:BBb_Standard BglBricks Standard Description Page] | ||
===Source=== | ===Source=== |
Latest revision as of 05:18, 22 October 2009
{VirG(IcsA)}
Assembly Compatibility:
- 10INCOMPATIBLE WITH RFC[10]Illegal SpeI site found at 330
Illegal SpeI site found at 777 - 12INCOMPATIBLE WITH RFC[12]Illegal SpeI site found at 330
Illegal SpeI site found at 777 - 21COMPATIBLE WITH RFC[21]
- 23INCOMPATIBLE WITH RFC[23]Illegal SpeI site found at 330
Illegal SpeI site found at 777 - 25INCOMPATIBLE WITH RFC[25]Illegal SpeI site found at 330
Illegal SpeI site found at 777 - 1000COMPATIBLE WITH RFC[1000]
Design Notes
This part is in BglBricks Standard. It is flanked by BamHI and BglII sites instead of XbaI and SpeI. More information about the BglBricks Standard is available at:
[http://openwetware.org/wiki/Template:AndersonLab:BBb_Standard BglBricks Standard Description Page]
Source
PCR O09ig302/O09ig301 on S. Flexneri (490bp, gp = frag1) PCR O09ig300/O09ig303 on S. Flexneri (986bp, gp = frag2) ---- PCR O09ig302/O09ig303 on mixed frags (1457bp, EcoRI/BamHI) Sub in pBca9523-Bca1144#5 (EcoRI/BamHI, 2472+1224, L) Product is pBca9523-B09ig302 {?VirG AtD?} ---- O09ig302 Forward PCR of {?VirG AtD?} (B09ig302) AAGTGGAATTCATGAGATCTTCGTCAAATGTCGGTCAGAC O09ig301 Reverse internal oligo for {?VirG AtD?} (B09ig302) CTGCCAGCCTCAGGGCGCC O09ig300 Forward internal oligo for {?VirG AtD?} (B09ig302) GGCGCCCTGAGGCTGGCAG O09ig303 Reverse PCR of {?VirG AtD?} (B09ig302) GTTAGGGATCCGAAGGTATATTTCACACCC