Difference between revisions of "Part:BBa K197011:Design"
JCAnderson (Talk | contribs) (→Design Notes) |
|||
Line 1: | Line 1: | ||
− | |||
__NOTOC__ | __NOTOC__ | ||
<partinfo>BBa_K197011 short</partinfo> | <partinfo>BBa_K197011 short</partinfo> | ||
Line 7: | Line 6: | ||
===Design Notes=== | ===Design Notes=== | ||
− | + | This part is in BglBricks Standard. It is flanked by BamHI and BglII sites instead of XbaI and SpeI. More information about the BglBricks Standard is available at: | |
− | + | ||
+ | [http://openwetware.org/wiki/Template:AndersonLab:BBb_Standard BglBricks Standard Description Page] | ||
===Source=== | ===Source=== |
Latest revision as of 05:17, 22 October 2009
{TshA}
Assembly Compatibility:
- 10INCOMPATIBLE WITH RFC[10]Illegal PstI site found at 861
Illegal PstI site found at 1206 - 12INCOMPATIBLE WITH RFC[12]Illegal PstI site found at 861
Illegal PstI site found at 1206 - 21COMPATIBLE WITH RFC[21]
- 23INCOMPATIBLE WITH RFC[23]Illegal PstI site found at 861
Illegal PstI site found at 1206 - 25INCOMPATIBLE WITH RFC[25]Illegal PstI site found at 861
Illegal PstI site found at 1206
Illegal NgoMIV site found at 1347 - 1000COMPATIBLE WITH RFC[1000]
Design Notes
This part is in BglBricks Standard. It is flanked by BamHI and BglII sites instead of XbaI and SpeI. More information about the BglBricks Standard is available at:
[http://openwetware.org/wiki/Template:AndersonLab:BBb_Standard BglBricks Standard Description Page]
Source
PCR ca998/O09ig283 on M10088 (1575, EcoRI/BamHI) Sub in pBca9523-Bca1144#5 (EcoRI/BamHI, 2472+1224, L) Product is pBca9523-O09ig283 {<TshA>} ------------------------------------- Ca998 forward oligo gtatcacgaggcagaatttcag O09ig283 reverse oligo with stop codons removed for {<TshA>} gacggGGATCCgaatgaataacgaatattag