Difference between revisions of "Part:BBa K4119011"
 
Line 13: Line 13:
 
<partinfo>BBa_K4119011 SequenceAndFeatures</partinfo>
 
<partinfo>BBa_K4119011 SequenceAndFeatures</partinfo>
  
 +
==<b>Contribution of NanjingBioX 2024 team</b>==
 +
==Results==
 +
===(1)Plasmid construction===
 +
Using pMTL-Pcat1 as a template, and vector-F and vector-R as primers, vector fragment was obtained by amplification. Using recombinant plasmid pET29a-BS2 as template, and Bs2-F and Bs2-R as primers, Bs2 fragment was obtained by amplification. Gibson assembly was used to ligate Bs2 fragment with the pMTL-Pcat1 linearized vector. Colony PCR was used for the transformed colonies using Pcat1-Bs2-CPF and Pcat1-Bs2-CPR as primers. The positive colonies were transferred, and the plasmids were extracted. Gene sequencing was used to verify the plasmid pMTL-Pcat1-Bs2.
  
 +
<html>
 +
<style>
 +
    table {
 +
        width: 100%;
 +
        border-collapse: collapse;
 +
    }
 +
 +
    table, th, td {
 +
        border: 1px solid black;
 +
    }
 +
 +
    th, td {
 +
        padding: 10px;
 +
        text-align: left;
 +
    }
 +
 +
    th {
 +
        background-color: #f2f2f2;
 +
    }
 +
</style>
 +
 +
<body>
 +
 +
<h2>Primers and Sequences</h2>
 +
 +
<table>
 +
    <tr>
 +
        <th>Primers</th>
 +
        <th>Primer Sequences (5’-3’)</th>
 +
    </tr>
 +
    <tr>
 +
        <td>vector-F</td>
 +
        <td>agcttcttgaataatatttttttaacatctattttg</td>
 +
    </tr>
 +
    <tr>
 +
        <td>vector-R</td>
 +
        <td>tgaaaacttgccataaaaaccaccctttcataaat</td>
 +
    </tr>
 +
    <tr>
 +
        <td>Bs2-F</td>
 +
        <td>aagggtggtttttatggcaagttttcaaagtt</td>
 +
    </tr>
 +
    <tr>
 +
        <td>Bs2-R</td>
 +
        <td>ttaaaaaaatattattcaagaagcttttcatat</td>
 +
    </tr>
 +
    <tr>
 +
        <td>Pcat1-Bs2-CPF</td>
 +
        <td>gtagactttaaggatggaac</td>
 +
    </tr>
 +
    <tr>
 +
        <td>Pcat1-Bs2-CPR</td>
 +
        <td>ggacgtcctatttttttaac</td>
 +
    </tr>
 +
</table>
 +
 +
</body>
 +
</html>
 +
 +
<html>
 +
<style>
 +
    .bild {max-width: 35% ; height: auto;}
 +
</style>
 +
<p>
 +
  <img class="bild" src="https://static.igem.wiki/teams/5206/nanjingbiox-parts/29.png">
 +
  <div class="unterschrift"><b> Fig. 1：PMTL-Pcat1-Bs2</b>
 +
  </div>
 +
</p>
 +
</html>
 +
 +
===(2) Plasmid construction===
 +
Pcat1 is a common promoter from Clostridium acetobutylicum ATCC 824 with native RBS (BBa_K4119011). Bs2 is one of the flavin mononucleotide (FMN)-based fluorescent proteins (BBa_K4119002), which is functional under anaerobic conditions, and thus can be employed as reporters in Clostridium. pMTL-Pcat1-Bs2 recombinant plasmid is used to express Bs2 using Pcat1 as the promoter.
 +
 +
pMTL-Pcat1-Bs2 was transfected into Clostridium tyrobutyricum, notated as Pcat1 in figures. The transfected C. tyrobutyricum were cultured for 48h. The fermentation broth was centrifuged, washed, and resuspended in PBS, and then the diluted bacterial solution was smeared on a glass slide. By using a fluorescence microscope, green fluorescence was observed (Fig. 2).
 +
 +
<html>
 +
<style>
 +
    .bild {max-width: 35% ; height: auto;}
 +
</style>
 +
<p>
 +
  <img class="bild" src="https://static.igem.wiki/teams/5206/nanjingbiox-parts/30.png">
 +
  <div class="unterschrift"><b> Fig. 2: Fluorescence microscopic image of C. tyrobutyricum transfected with pMTL-Pcat1-Bs2 recombinant plasmid</b>
 +
  </div>
 +
</p>
 +
</html>
 +
 +
 +
The transfected C. tyrobutyricum (notated as Pcat1 in Figure 3) were cultured till OD600 reached 1.0, and then were taken for fluorescence intensity detection. C. tyrobutyricum strain with empty plasmid pMTL82151 was as a blank control (notated as Control). The fluorescence intensity of Pcat1 under OD600=1.0 was 21523.1. Pcat1 showed stronger intensity than Control.
 +
 +
<html>
 +
<style>
 +
    .bild {max-width: 35% ; height: auto;}
 +
</style>
 +
<p>
 +
  <img class="bild" src="https://static.igem.wiki/teams/5206/nanjingbiox-parts/31.png">
 +
  <div class="unterschrift"><b> Fig. 3: Fluorescence intensity of C. tyrobutyricum transfected with pMTL-Pcat1-Bs2 recombinant plasmid (Pcat1) and C. tyrobutyricum transfected with empty plasmid pMTL82151 (Control)</b>
 +
  </div>
 +
</p>
 +
</html>
 
<!-- Uncomment this to enable Functional Parameter display  
 
<!-- Uncomment this to enable Functional Parameter display  
 
===Functional Parameters===
 
===Functional Parameters===
 
<partinfo>BBa_K4119011 parameters</partinfo>
 
<partinfo>BBa_K4119011 parameters</partinfo>
 
<!-- -->
 
<!-- -->

Latest revision as of 18:28, 1 October 2024


cat1 promoter Pcat1

A Constitutive Promoter from Clostridium acetobutylicum ATCC 824, with native RBS.
In our project, this promoter was used to express fnr coding sequence.

Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    COMPATIBLE WITH RFC[1000]

Contribution of NanjingBioX 2024 team

Results

(1)Plasmid construction

Using pMTL-Pcat1 as a template, and vector-F and vector-R as primers, vector fragment was obtained by amplification. Using recombinant plasmid pET29a-BS2 as template, and Bs2-F and Bs2-R as primers, Bs2 fragment was obtained by amplification. Gibson assembly was used to ligate Bs2 fragment with the pMTL-Pcat1 linearized vector. Colony PCR was used for the transformed colonies using Pcat1-Bs2-CPF and Pcat1-Bs2-CPR as primers. The positive colonies were transferred, and the plasmids were extracted. Gene sequencing was used to verify the plasmid pMTL-Pcat1-Bs2.

Primers and Sequences

Primers Primer Sequences (5’-3’)
vector-F agcttcttgaataatatttttttaacatctattttg
vector-R tgaaaacttgccataaaaaccaccctttcataaat
Bs2-F aagggtggtttttatggcaagttttcaaagtt
Bs2-R ttaaaaaaatattattcaagaagcttttcatat
Pcat1-Bs2-CPF gtagactttaaggatggaac
Pcat1-Bs2-CPR ggacgtcctatttttttaac

Fig. 1：PMTL-Pcat1-Bs2

(2) Plasmid construction

Pcat1 is a common promoter from Clostridium acetobutylicum ATCC 824 with native RBS (BBa_K4119011). Bs2 is one of the flavin mononucleotide (FMN)-based fluorescent proteins (BBa_K4119002), which is functional under anaerobic conditions, and thus can be employed as reporters in Clostridium. pMTL-Pcat1-Bs2 recombinant plasmid is used to express Bs2 using Pcat1 as the promoter.

pMTL-Pcat1-Bs2 was transfected into Clostridium tyrobutyricum, notated as Pcat1 in figures. The transfected C. tyrobutyricum were cultured for 48h. The fermentation broth was centrifuged, washed, and resuspended in PBS, and then the diluted bacterial solution was smeared on a glass slide. By using a fluorescence microscope, green fluorescence was observed (Fig. 2).

Fig. 2: Fluorescence microscopic image of C. tyrobutyricum transfected with pMTL-Pcat1-Bs2 recombinant plasmid


The transfected C. tyrobutyricum (notated as Pcat1 in Figure 3) were cultured till OD600 reached 1.0, and then were taken for fluorescence intensity detection. C. tyrobutyricum strain with empty plasmid pMTL82151 was as a blank control (notated as Control). The fluorescence intensity of Pcat1 under OD600=1.0 was 21523.1. Pcat1 showed stronger intensity than Control.

Fig. 3: Fluorescence intensity of C. tyrobutyricum transfected with pMTL-Pcat1-Bs2 recombinant plasmid (Pcat1) and C. tyrobutyricum transfected with empty plasmid pMTL82151 (Control)