Difference between revisions of "Part:BBa K5201001"

 
Line 1: Line 1:
−
 
 
__NOTOC__
 
__NOTOC__
 
<partinfo>BBa_K5201001 short</partinfo>
 
<partinfo>BBa_K5201001 short</partinfo>
Line 9: Line 8:
 
UGDH is endogenously expressed in a low level in E. coli, our recombinant plasmid will overexpress UGDH under an inducible promoter (BBa_R0010). We hope that overexpression of kfiD can increase production of Hyaluronic Acid (HA), by converting UDP-glucose to UDP-glucuronic acid, one of the precursors of HA. HA is widely utilized by the cosmetic industry for its significant water absorption and retention properties. And therefore, we want to further implement it for agricultural use.  
 
UGDH is endogenously expressed in a low level in E. coli, our recombinant plasmid will overexpress UGDH under an inducible promoter (BBa_R0010). We hope that overexpression of kfiD can increase production of Hyaluronic Acid (HA), by converting UDP-glucose to UDP-glucuronic acid, one of the precursors of HA. HA is widely utilized by the cosmetic industry for its significant water absorption and retention properties. And therefore, we want to further implement it for agricultural use.  
  
−
<!-- Add more about the biology of this part here
+
<!-- Add more about the biology of this part here-->
 
===Usage and Biology===
 
===Usage and Biology===
−
 
+
__NOTOC__
 +
===Characterisation of BBa_K5201001: HongKong-UCCKE===
 +
<html lang="en">
 +
<head>
 +
    <meta charset="UTF-8">
 +
    <meta name="viewport" content="width=device-width, initial-scale=1.0">
 +
    <title>Document</title>
 +
<style>
 +
table {
 +
width: 100%;
 +
border-collapse: collapse;
 +
}
 +
tr {
 +
max-width: 950px;
 +
}
 +
td {
 +
max-width: 600px;
 +
word-wrap: break-word;
 +
padding: 10px;
 +
}
 +
</style>
 +
</head>
 +
<body>
 +
<table>
 +
  <tr>
 +
    <td>
 +
      <p>Part registry </p>
 +
    </td>
 +
    <td>
 +
      <p>BBa_K5201001</p>
 +
    </td>
 +
  </tr>
 +
  <tr>
 +
    <td>
 +
      <p>Part type </p>
 +
    </td>
 +
    <td>
 +
      <p>Coding sequence </p>
 +
    </td>
 +
  </tr>
 +
  <tr>
 +
    <td>
 +
      <p>Short description </p>
 +
    </td>
 +
    <td>
 +
      <p><i>kfiD </i>is a gene originated from <i>E. coli K5 strain, </i>codons are optimized for overexpression of UDP-glucose-6-dehydrogenase (UGDH) in <i>E. coli</i></p>
 +
    </td>
 +
  </tr>
 +
  <tr>
 +
    <td>
 +
      <p>Long description </p>
 +
    </td>
 +
    <td>
 +
      <p>Biology </p>
 +
      <p><i>kfiD </i>encodes UDP-glucose-6-dehydrogenase (UGDH) from <i>E. coli K5</i> strain. </p>
 +
      <br></br>
 +
      <p>Usage and design </p>
 +
      <p>UGDH is endogenously expressed in a low level in <i>E. coli, </i>our recombinant plasmid will overexpress  UGDH under an inducible promoter (BBa_R0010). We hope that overexpression of <i>kfiD </i>can increase production of Hyaluronic Acid, by converting UDP-glucose to UDP-glucuronic acid, one of the precursors of HA. HA is widely utilized by the cosmetic industry for its significant water absorption and retention properties. And therefore, we want to further implement it for agricultural use. </p>
 +
    </td>
 +
  </tr>
 +
  <tr>
 +
    <td>
 +
      <p>Source </p>
 +
    </td>
 +
    <td>
 +
      <p><i>E. coli K5 strain </i></p>
 +
    </td>
 +
  </tr>
 +
  <tr>
 +
    <td>
 +
      <p>Design consideration </p>
 +
    </td>
 +
    <td>
 +
      <p><i>kfiD </i>is designed to optimize over-expression for <i>E. coliI</i>. This ensures a high amount of UDP-glucuronic acid, and hence, HA can be produced</p>
 +
    </td>
 +
  </tr>
 +
  <tr>
 +
    <td>
 +
      <p>Sequence </p>
 +
    </td>
 +
    <td>
 +
      <p>gaattcgcggccgcttctagagatgcatcaccatcatcaccacttcggtaccctgaagatcacggtcagcggtgcgggctacgtgggtctttccaatggcatcctcatggcccagaaccacgaagtagtggcttttgatacccaccagaaaaaagtggatttactgaacgacaaattgagcccgattgaagataaggaaatcgagaattacctgtccacaaagatcttaaactttcgcgccactaccaataagtatgaagcctacaaaaatgcaaactatgtaattatcgcgacgccgactaattatgaccccggttctaactatttcgataccagtagtgtcgaagcggtgattcgtgatgtcacggaaatcaatccgaacgcgataatggttattaagagcaccgttccggtcggattcacgaaaactattaaagaacatctgggtatcaataacattatttttagtcccgaatttctgcgtgaaggccgcgcgttatatgacaacctacatccgtcacgcatcatcattggtgagcgctctgagcgcgcggaacgtcttgcggtgttattccaggaaggcgctatcaaacaaaatattcctgttttgtttaccgactcaaccgaagcagaagccataaaactgtttagcaacacatatctggcgatgcgagttgcattcttcaacgagctggatagctacgcagaaagcttcggactgaatacacgacagatcattgatggggtatgcctggatcctcgcattggcaactactacaataaccctagctttggttatggcggctattgcctgccgaaagataccaagcagctgcttgcgaactatcagtcagtgccgaacaaacttatttcggccattgtcgatgcaaatcgcaccaggaaagatttcatcaccaatgtgattttgaagcatcgtccacaagtagtgggcgtttatcgtctgattatgaaaagtggatcggataacttccgcgactcgtcaattctgggcattatcaaacgtatcaaagaaaaaggcgtgaaagttattatatacgagccgttgatttccggggatactttttttaactctccactcgagcgtgagctggccatttttaaagggaaagccgacattattattacgaatcgcatgagcgaagaattaaatgacgttgtggataaagtgtactcgcgggacctctttaaatgtgattactagtagcggccgctgcag</p>
 +
    </td>
 +
  </tr>
 +
  <tr>
 +
    <td>
 +
      <p>Start codon </p>
 +
    </td>
 +
    <td>
 +
      <br></br>
 +
    </td>
 +
  </tr>
 +
  <tr>
 +
    <td>
 +
      <p>Stop codon </p>
 +
    </td>
 +
    <td>
 +
      <br></br>
 +
    </td>
 +
  </tr>
 +
  <tr>
 +
    <td>
 +
      <p>Assembly compatibility </p>
 +
    </td>
 +
    <td>
 +
      <p>rfc10</p>
 +
    </td>
 +
  </tr>
 +
</table>
 +
</body>
 +
</html>
 
<!-- -->
 
<!-- -->
 
<span class='h3bb'>Sequence and Features</span>
 
<span class='h3bb'>Sequence and Features</span>

Revision as of 14:50, 1 October 2024

kfiD codons are optimized for overexpression of UDP-glucose-6-dehyrogenase

Biology kfiD encodes UDP-glucose-6-dehydrogenase (UGDH) from E. coli K5 strain.

Usage and design UGDH is endogenously expressed in a low level in E. coli, our recombinant plasmid will overexpress UGDH under an inducible promoter (BBa_R0010). We hope that overexpression of kfiD can increase production of Hyaluronic Acid (HA), by converting UDP-glucose to UDP-glucuronic acid, one of the precursors of HA. HA is widely utilized by the cosmetic industry for its significant water absorption and retention properties. And therefore, we want to further implement it for agricultural use.

Usage and Biology

Characterisation of BBa_K5201001: HongKong-UCCKE

Document

Part registry

BBa_K5201001

Part type

Coding sequence

Short description

kfiD is a gene originated from E. coli K5 strain, codons are optimized for overexpression of UDP-glucose-6-dehydrogenase (UGDH) in E. coli

Long description

Biology

kfiD encodes UDP-glucose-6-dehydrogenase (UGDH) from E. coli K5 strain.



Usage and design

UGDH is endogenously expressed in a low level in E. coli, our recombinant plasmid will overexpress UGDH under an inducible promoter (BBa_R0010). We hope that overexpression of kfiD can increase production of Hyaluronic Acid, by converting UDP-glucose to UDP-glucuronic acid, one of the precursors of HA. HA is widely utilized by the cosmetic industry for its significant water absorption and retention properties. And therefore, we want to further implement it for agricultural use.

Source

E. coli K5 strain

Design consideration

kfiD is designed to optimize over-expression for E. coliI. This ensures a high amount of UDP-glucuronic acid, and hence, HA can be produced

Sequence

gaattcgcggccgcttctagagatgcatcaccatcatcaccacttcggtaccctgaagatcacggtcagcggtgcgggctacgtgggtctttccaatggcatcctcatggcccagaaccacgaagtagtggcttttgatacccaccagaaaaaagtggatttactgaacgacaaattgagcccgattgaagataaggaaatcgagaattacctgtccacaaagatcttaaactttcgcgccactaccaataagtatgaagcctacaaaaatgcaaactatgtaattatcgcgacgccgactaattatgaccccggttctaactatttcgataccagtagtgtcgaagcggtgattcgtgatgtcacggaaatcaatccgaacgcgataatggttattaagagcaccgttccggtcggattcacgaaaactattaaagaacatctgggtatcaataacattatttttagtcccgaatttctgcgtgaaggccgcgcgttatatgacaacctacatccgtcacgcatcatcattggtgagcgctctgagcgcgcggaacgtcttgcggtgttattccaggaaggcgctatcaaacaaaatattcctgttttgtttaccgactcaaccgaagcagaagccataaaactgtttagcaacacatatctggcgatgcgagttgcattcttcaacgagctggatagctacgcagaaagcttcggactgaatacacgacagatcattgatggggtatgcctggatcctcgcattggcaactactacaataaccctagctttggttatggcggctattgcctgccgaaagataccaagcagctgcttgcgaactatcagtcagtgccgaacaaacttatttcggccattgtcgatgcaaatcgcaccaggaaagatttcatcaccaatgtgattttgaagcatcgtccacaagtagtgggcgtttatcgtctgattatgaaaagtggatcggataacttccgcgactcgtcaattctgggcattatcaaacgtatcaaagaaaaaggcgtgaaagttattatatacgagccgttgatttccggggatactttttttaactctccactcgagcgtgagctggccatttttaaagggaaagccgacattattattacgaatcgcatgagcgaagaattaaatgacgttgtggataaagtgtactcgcgggacctctttaaatgtgattactagtagcggccgctgcag

Start codon



Stop codon



Assembly compatibility

rfc10
Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    INCOMPATIBLE WITH RFC[21]
    Illegal BglII site found at 200
    Illegal BamHI site found at 732
    Illegal XhoI site found at 1075
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    COMPATIBLE WITH RFC[1000]