Difference between revisions of "Part:BBa K5384004"
(→‎References)
Line 19: Line 19:
  
 
===References===
 
===References===
−
[1]PORTELA RUI M. C., VOGL THOMAS, EBNER KATHARINA, et al. Pichia pastoris Alcohol Oxidase 1Pichia pastoris Alcohol Oxidase 1(AOX1) Core Promoter Engineering by High Resolution Systematic Mutagenesis[J]. Biotechnology Journal:Healthcare,Nutrition,Technology,2018,13(3):1700340-1-1700340-8.  
+
[1] PORTELA RUI M. C., VOGL THOMAS, EBNER KATHARINA, et al. Pichia pastoris Alcohol Oxidase 1Pichia pastoris Alcohol Oxidase 1(AOX1) Core Promoter Engineering by High Resolution Systematic Mutagenesis[J]. Biotechnology Journal:Healthcare,Nutrition,Technology,2018,13(3):1700340-1-1700340-8.  
  
−
[2]XIONG Xianghua, ZHAO Hongliang, XUE Chong, et al. Isolation and Identification of Pichia Alcohol Oxidase 1 Promoter Mutants[J]. Biotechnology Letters,2008,19(1):11-13.] DOI:10.3969/j.issn.1009-0002.2008.01.004.
+
[2] XIONG Xianghua, ZHAO Hongliang, XUE Chong, et al. Isolation and Identification of Pichia Alcohol Oxidase 1 Promoter Mutants[J]. Biotechnology Letters,2008,19(1):11-13.] DOI:10.3969/j.issn.1009-0002.2008.01.004.
  
−
[3]BAURAIN D, DINANT M, COOSEMANS N, et al. Regulation of the alternative oxidase Aox1 gene in Chlamydomonas reinhardtii. Role of the nitrogen source on the expression of a reporter gene under the control of the Aox1 promoter[J]. Plant physiology,2003,131(3):1418-1430.
+
[3] BAURAIN D, DINANT M, COOSEMANS N, et al. Regulation of the alternative oxidase Aox1 gene in Chlamydomonas reinhardtii. Role of the nitrogen source on the expression of a reporter gene under the control of the Aox1 promoter[J]. Plant physiology,2003,131(3):1418-1430.
  
−
[4]WANG, XIAOLONG, CAI, MENGHAO, SHI, LEI, et al. PpNrg1 is a transcriptional repressor for glucose and glycerol repression of AOX1 promoter in methylotrophic yeast Pichia pastoris[J]. Biotechnology Letters,2016,38(2):291-298. DOI:10.1007/s10529-015-1972-4.
+
[4] WANG, XIAOLONG, CAI, MENGHAO, SHI, LEI, et al. PpNrg1 is a transcriptional repressor for glucose and glycerol repression of AOX1 promoter in methylotrophic yeast Pichia pastoris[J]. Biotechnology Letters,2016,38(2):291-298. DOI:10.1007/s10529-015-1972-4.

Revision as of 08:49, 1 October 2024


AOX 1 promoter

The Pichia pastoris alcohol oxidase 1 (AOX1) promoter variant is characterized by comprising at least one of the specified modifications in the wild-type Pichia pastoris AOX1 promoter of SEQ ID NO: 1. a) Nucleotides 94-110 (-847-831), Nucleotides 141-160 (-800--781), Nucleotides 312-330 (-629-6-111), Nucleotides 355-380 (-586-561), Nucleotides 501-521 (-440-420); inside nucleotides 640-658 (-301--283), nucleotides 674-693 (-267--248) and nucleotides 1-840 (-940--100). Integration of the Cat8 transcription factor binding site (TFBS) at any position, in particular the integration of the "TTCCGTTCGTCCGA" gene sequence or other gene sequence showing at least 80％ similarity to this sequence; b) Nucleotides 1-840 (-). Integration of Aca1 or Aca2 TFBS at any position between 940--100), particularly integration of the "GCCATTTGTAGACGTCAACCC" nucleotide sequence or other gene sequence showing at least 80％ similarity to this sequence; c) Nucleotide 94 Within ~ 693 (-847 to -248), the mutation specified by SEQ ID NO: 2 as well as the mutation selected from the group consisting of combinations thereof are included, and the AOX1 promoter variant further comprises the wild-type AOX1 promoter described above. When compared to, it is characterized by its increased strength and guiding ability.[1,2]


Usage and Biology

We show that the Aox1 promoter is generally unresponsive to a number of known AOX inducers, including stress agents, respiratory inhibitors, and metabolites, possibly because the AOX activity is constitutively high in the plasmids.[3,4]

Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    COMPATIBLE WITH RFC[1000]


References

[1] PORTELA RUI M. C., VOGL THOMAS, EBNER KATHARINA, et al. Pichia pastoris Alcohol Oxidase 1Pichia pastoris Alcohol Oxidase 1(AOX1) Core Promoter Engineering by High Resolution Systematic Mutagenesis[J]. Biotechnology Journal:Healthcare,Nutrition,Technology,2018,13(3):1700340-1-1700340-8.

[2] XIONG Xianghua, ZHAO Hongliang, XUE Chong, et al. Isolation and Identification of Pichia Alcohol Oxidase 1 Promoter Mutants[J]. Biotechnology Letters,2008,19(1):11-13.] DOI:10.3969/j.issn.1009-0002.2008.01.004.

[3] BAURAIN D, DINANT M, COOSEMANS N, et al. Regulation of the alternative oxidase Aox1 gene in Chlamydomonas reinhardtii. Role of the nitrogen source on the expression of a reporter gene under the control of the Aox1 promoter[J]. Plant physiology,2003,131(3):1418-1430.

[4] WANG, XIAOLONG, CAI, MENGHAO, SHI, LEI, et al. PpNrg1 is a transcriptional repressor for glucose and glycerol repression of AOX1 promoter in methylotrophic yeast Pichia pastoris[J]. Biotechnology Letters,2016,38(2):291-298. DOI:10.1007/s10529-015-1972-4.