Difference between revisions of "Part:BBa K5267005"
Line 32: Line 32:
 
===Special design===
 
===Special design===
 
In part 4xCRE-Pmin (BBa_K5267004), we demonstrated that CRE can promote downstream gene transcription after binding to CREB. However, we cannot be sure that 4 multimerized CRE sequence incorporating a 5′ minimal promoter is the best choice to promote expression. In order to select the best number of clones，in this parts ，we constructed the 5xCRE-Pmin sequence, containing a 5′ minimal promoter with 5 multimerized CREs.
 
In part 4xCRE-Pmin (BBa_K5267004), we demonstrated that CRE can promote downstream gene transcription after binding to CREB. However, we cannot be sure that 4 multimerized CRE sequence incorporating a 5′ minimal promoter is the best choice to promote expression. In order to select the best number of clones，in this parts ，we constructed the 5xCRE-Pmin sequence, containing a 5′ minimal promoter with 5 multimerized CREs.
 +
===Function Test===
 +
==Method==
 +
Forskolin (Coleonol) is a potent adenylate cyclase activator with an IC50 of 41nM and an EC50 of 0.5μM for type I adenylyl cyclase[5], which can stimulate cAMP concentration to increase.
 +
To validate our basic part 4xCRE_Pmin(BBa), which can work as the binding site ofCREB(cAMP response element binding protein), initiating transcriptional activation, Weconstructed pNC005 pLM010, a plasmid carrying 4xCRE_Pmin- IgK->Nluc->bGH_polyA (BBa) and Pmin _IgK->Nluc->bGH_polyA (BBa). When When transfected cells were stimulated by Forskolin causing intracellular cAMP concentration increased, the two groups are reciprocally used as control groups.
 +
==Result==
  
 +
<html>
  
−
===Function test===
+
<figure class="figure">
−
In order to test the function of cAMP response element, multiple CRE sequences and Pmin were loaded onto vector that equipped with sleeping beauty transposon site, where IgK-Nluc reporter gene added downstream. If the incandescent sequence responds successfully, the Nluc gene will be successfully expressed. '''(Figure 1)'''
+
<div style="width=100%;height=auto">
−
<br>In Figure 1,we can find that the expression level of Nluc gene in cells supplemented with 4XGRE-Pmin was significantly increased compared with the blank control, which proved that the CRE sequence responded successfully.
+
< img src="https://static.igem.wiki/teams/5267/mao-parts/4xcre.jpg" class="figure-img img-fluid rounded"  height="400px">
  
 +
</figure>
  
−
===Sequence===
+
</html>
−
<br>cagcctgacgtccgagtcgcgtagcctgacgtccgagagccgtagcctgacgtccgagggtaccagcctgacgtccg
+
Figure 1:  The expression of Nluc gene in different transfected cells was stimulated by forsklin for 48h
−
<br>agagccgtagcctgacgtccgagtactccgtagagggtatataatggaagctcgacttccag
+
The result shows that  a significant increase of the expression of Nluc gene compared to the control group, indicating that in the experimental group, the CRE sequence responded successfully. 
 +
<p>The result successfully proved our system can work as we expected—when cAMP concentration increases, the CREB will bind with CRE sequence promoting expression of gene downstream.</p>
  
  
Line 47: Line 55:
 
[1] M. Montminy, "Transcriptional regulation by cyclic AMP," Annu Rev Biochem, vol. 66, pp. 807-22, 1997, doi: 10.1146/annurev.biochem.66.1.807.
 
[1] M. Montminy, "Transcriptional regulation by cyclic AMP," Annu Rev Biochem, vol. 66, pp. 807-22, 1997, doi: 10.1146/annurev.biochem.66.1.807.
 
<br>[2] A. J. Shaywitz and M. E. Greenberg, "CREB: a stimulus-induced transcription factor activated by a diverse array of extracellular signals," Annu Rev Biochem, vol. 68, pp. 821-61, 1999, doi: 10.1146/annurev.biochem.68.1.821.
 
<br>[2] A. J. Shaywitz and M. E. Greenberg, "CREB: a stimulus-induced transcription factor activated by a diverse array of extracellular signals," Annu Rev Biochem, vol. 68, pp. 821-61, 1999, doi: 10.1146/annurev.biochem.68.1.821.
 +
<br>[3] J. D. Robbins, D. L. Boring, W. J. Tang, R. Shank, and K. B. Seamon, "Forskolin carbamates: binding and activation studies with type I adenylyl cyclase," J Med Chem, vol. 39, no. 14, pp. 2745-52, Jul 5 1996, doi: 10.1021/jm960191+.

Revision as of 18:19, 28 September 2024


P_5xCRE

As the response element to report whether melatonin is accepted or not Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    INCOMPATIBLE WITH RFC[21]
    Illegal BglII site found at 103
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    COMPATIBLE WITH RFC[1000]


Profile

Name: 5xCRE-Pmin
Base Pairs: 138bp
Origin: Homo sapiens
Properties: As the response element to report whether melatonin is accepted or not


Usage and Biology

CRE(cAMP response element)play an important role as the binding site of CREB(cAMP response element binding protein) ,which is typically found within 100 nucleotides of the TATA Box. CREB binds to cAMP response elements and recruits transcriptional coactivators (such as CBP/p300) to form transcription complexes that initiate transcription of target genes.[1]

TATA Box is one of the components that constitute the promoter of eukaryotes. The consistent order is TATA(A/T)A(A/T) (non-template chain sequence). It is about -30bp (-25~-32bp) upstream of the transcription starting point of most eukaryotic genes, and is basically composed of A-T base pairs, which determines the selection of gene transcription and is one of the binding sites of RNA polymerase. RNA polymerase can only start transcription after firmly binding to the TATA Box. The ability of CRE sequences to mediate transcriptional activation in response to cAMP appears to be somewhat promoter dependen[1],in this experiment, TATA box of the commonly used CMV promoter was selected to minimize to the minimum amount of nucleotides for transcription and named Pmin.

The activity of CREB is modulated by a plethora of signaling cascades, including three downstream pathways that are activated by the melatonin receptor MT1/2 in response to melatonin stimulation: the cAMP/PKA pathway, the calcium (Ca2+) signaling pathway, and MAPK/ERK pathway.[2] Consequently, CRE can be employed as a diagnostic element to assess the successful activation of the melatonin receptor's downstream signaling pathways.


Special design

In part 4xCRE-Pmin (BBa_K5267004), we demonstrated that CRE can promote downstream gene transcription after binding to CREB. However, we cannot be sure that 4 multimerized CRE sequence incorporating a 5′ minimal promoter is the best choice to promote expression. In order to select the best number of clones，in this parts ，we constructed the 5xCRE-Pmin sequence, containing a 5′ minimal promoter with 5 multimerized CREs.

Function Test

Method

Forskolin (Coleonol) is a potent adenylate cyclase activator with an IC50 of 41nM and an EC50 of 0.5μM for type I adenylyl cyclase[5], which can stimulate cAMP concentration to increase. To validate our basic part 4xCRE_Pmin(BBa), which can work as the binding site ofCREB(cAMP response element binding protein), initiating transcriptional activation, Weconstructed pNC005 pLM010, a plasmid carrying 4xCRE_Pmin- IgK->Nluc->bGH_polyA (BBa) and Pmin _IgK->Nluc->bGH_polyA (BBa). When When transfected cells were stimulated by Forskolin causing intracellular cAMP concentration increased, the two groups are reciprocally used as control groups.

Result

< img src="https://static.igem.wiki/teams/5267/mao-parts/4xcre.jpg" class="figure-img img-fluid rounded" height="400px">
Figure 1: The expression of Nluc gene in different transfected cells was stimulated by forsklin for 48h The result shows that a significant increase of the expression of Nluc gene compared to the control group, indicating that in the experimental group, the CRE sequence responded successfully.

The result successfully proved our system can work as we expected—when cAMP concentration increases, the CREB will bind with CRE sequence promoting expression of gene downstream.


Reference

[1] M. Montminy, "Transcriptional regulation by cyclic AMP," Annu Rev Biochem, vol. 66, pp. 807-22, 1997, doi: 10.1146/annurev.biochem.66.1.807.
[2] A. J. Shaywitz and M. E. Greenberg, "CREB: a stimulus-induced transcription factor activated by a diverse array of extracellular signals," Annu Rev Biochem, vol. 68, pp. 821-61, 1999, doi: 10.1146/annurev.biochem.68.1.821.
[3] J. D. Robbins, D. L. Boring, W. J. Tang, R. Shank, and K. B. Seamon, "Forskolin carbamates: binding and activation studies with type I adenylyl cyclase," J Med Chem, vol. 39, no. 14, pp. 2745-52, Jul 5 1996, doi: 10.1021/jm960191+.