Difference between revisions of "Part:BBa K5317020"

(→‎Cloning)
(→‎Cloning)
Line 86: Line 86:
  
 
</html>
 
</html>
 +
 +
<html>
 +
<center>
 +
<img src="https://static.igem.wiki/teams/5317/grar-mrubx2.png" style="width: 50%; height: 50%">
 +
</p>
 +
</center>
 +
</html>
 +
 +
Figure 1: Assembled vector map with graR-mRuby2 integrated into the pEGFP-C2 backbone.
  
 
=Characterisation=
 
=Characterisation=

Revision as of 17:23, 27 September 2024


CMV-GraR-mRuby2

Usage and Biology

Contained within are two key genes: mRuby2, a red fluorescent protein for live-cell imaging, and graR, a regulator that might bind to PknB upon phosphorylating GraR. . GraR is known for its role in β-lactam resistance by upregulating cell wall biosynthesis genes, altering cell wall composition, and increasing expression of ABC-transporter (El-Halfawy et al., 2020),(Yang et al., 2012),(Meehl et al., 2007). The GraSR system was found to control genes involved in stress response, cell wall metabolism and virulence pathways, in addition to playing an important role in CAMP resistance (Falord et al., 2011). When activated by pknB, GraR binds to specific DNA sequences to regulate gene expression, in our case it presumably binds to a specific engineered promotor.

Cloning

Theoretical Part Design

We placed the mRuby2 fluorescent marker (K5317001) downstream behind graR to visualize localisation of graR when stimulated with ß-lactam antibiotics . This gene was codon optimised for human cell lines.


Sequence and features


Assembly Compatibility:
  • 10
    INCOMPATIBLE WITH RFC[10]
    Illegal XbaI site found at 889
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    INCOMPATIBLE WITH RFC[23]
    Illegal XbaI site found at 889
  • 25
    INCOMPATIBLE WITH RFC[25]
    Illegal XbaI site found at 889
  • 1000
    INCOMPATIBLE WITH RFC[1000]
    Illegal SapI.rc site found at 1342

Cloning

This part was engineered with NEBBuilder® HIFI assembly method. First the backbone was linearized with NheI and BamHI and matching ends of gene and backbone ensured seamless cloning of GraR. In mammalian systems, this part is useful for studying the potential interactions between GraR and PknB. This part was amplified by using the primers in table 1.

HTML Table Caption Table1: Primers used to extract the graR gene sequence.

Primer name Sequence
graR_fw_1 TGAACCGTCAGATCCGatgcaaatactactagtagaagatgacaatactttgt
graR_rv_2 tggatccccttcatgagccatatatccttttcctacttttgt
graR_fw_3 tggatccccttcatgagccatatatccttttcctacttttgt
graR_rv_4 TCAGTTATCTAGATCCGGTGttacttgtacagctcgtccatcccacc

Figure 1: Assembled vector map with graR-mRuby2 integrated into the pEGFP-C2 backbone.

Characterisation

References

El-Halfawy, O. M., Czarny, T. L., Flannagan, R. S., Day, J., Bozelli, J. C., Kuiack, R. C., Salim, A., Eckert, P., Epand, R. M., McGavin, M. J., Organ, M. G., Heinrichs, D. E., & Brown, E. D. (2020). Discovery of an antivirulence compound that reverses β-lactam resistance in MRSA. Nature Chemical Biology, 16(2), 143–149. https://doi.org/10.1038/s41589-019-0401-8

Falord, M., Mäder, U., Hiron, A., Débarbouillé, M., & Msadek, T. (2011). Investigation of the Staphylococcus aureus GraSR Regulon Reveals Novel Links to Virulence, Stress Response and Cell Wall Signal Transduction Pathways. PLoS ONE, 6(7), e21323. https://doi.org/10.1371/journal.pone.0021323

Meehl, M., Herbert, S., Götz, F., & Cheung, A. (2007). Interaction of the GraRS Two-Component System with the VraFG ABC Transporter To Support Vancomycin-Intermediate Resistance in Staphylococcus aureus. Antimicrobial Agents and Chemotherapy, 51(8), 2679–2689. https://doi.org/10.1128/AAC.00209-07

Yang, S.-J., Bayer, A. S., Mishra, N. N., Meehl, M., Ledala, N., Yeaman, M. R., Xiong, Y. Q., & Cheung, A. L. (2012). The Staphylococcus aureus Two-Component Regulatory System, GraRS, Senses and Confers Resistance to Selected Cationic Antimicrobial Peptides. Infection and Immunity, 80(1), 74–81. https://doi.org/10.1128/IAI.05669-11