Difference between revisions of "Part:BBa K5317021"

(Theoretical Part Design)
(Theoretical Part Design)
Line 73: Line 73:
 
</body>  
 
</body>  
 
   
 
   
 +
<html>
 +
 +
 
===Sequence and features===
 
===Sequence and features===
  

Revision as of 16:52, 27 September 2024


CMV-ATF2-mRuby2

Usage and Biology

ATF2 belongs to the ATF/CREB family (Kirsch et al., 2020) and its phosphorylation by PknB, making it important for research into signaling pathways related to cell stress and survival, while mRuby2 provides a fluorescent marker for visualisation. In our cell-based & #946;-lactam ring-containing antibiotics sensor, ATF2 serves as a translator of changes in PknB activity at the level of gene regulation, in particular the activity of the ATF2-3xCre2xAP1 promoter.

Cloning

Theoretical Part Design

We placed the mRuby2 fluorescent marker (K5317001) downstream behind ATF2 (K5317015). This gene was codon optimised for human cell lines. This part was amplified by using the primers in table 1.

HTML Table Caption Table1: Primers used to extract the ATF2 gene sequence.

Primer name Sequence
ATF2_fw_1 TGAACCGTCAGATCCGatgaaattcaagttacatgtgaattctgccag
ATF2_rv_2 ggatccccacttcctgagggctgtgac
ATF2_fw_3 caggaagtggggatccaccggtcg
ATF2_rv_4 TCAGTTATCTAGATCCGGTGcttgtacagctcgtccatccc
===Sequence and features=== BBa_K5317021 ===Cloning=== Furthermore, the CMV promoter ensures robust expression in mammalian systems (Radhakrishnan ''et al.'', 2008) that can be easily detected and analysed. This composite part was engineered with NEBBuilder® HIFI assembly method. We linearized eGFP-C2 with BamHI and AseI inserting a linked ATF2 and mRuby seamlessly. =Characterisation= ===References=== Kirsch, K., Zeke, A., Tőke, O., Sok, P., Sethi, A., Sebő, A., Kumar, G. S., Egri, P., Póti, Á. L., Gooley, P., Peti, W., Bento, I., Alexa, A., & Reményi, A. (2020). Co-regulation of the transcription controlling ATF2 phosphoswitch by JNK and p38. ''Nature Communications'', 11(1), 5769. https://doi.org/10.1038/s41467-020-19582-3 Radhakrishnan, P., Basma, H., Klinkebiel, D., Christman, J., & Cheng, P.-W. (2008). Cell type-specific activation of the cytomegalovirus promoter by dimethylsulfoxide and 5-Aza-2’-deoxycytidine. ''The International Journal of Biochemistry & Cell Biology'', 40(9), 1944–1955. https://doi.org/10.1016/j.biocel.2008.02.014