Difference between revisions of "Part:BBa K5267010"

Revision as of 18:00, 25 September 2024

Pmin_7*NFAT promoter

Transpose and respond to calcium ion signals Sequence and Features

Assembly Compatibility:

10
COMPATIBLE WITH RFC[10]
12
COMPATIBLE WITH RFC[12]
21
COMPATIBLE WITH RFC[21]
23
COMPATIBLE WITH RFC[23]
25
COMPATIBLE WITH RFC[25]
1000
COMPATIBLE WITH RFC[1000]

Profile

Name: Pmin_7*NFAT promoter
Base Pairs: 249bp
Origin: Homo sapiens
Properties: Transpose and respond to calcium ion signals

Usage and Biology

Nuclear factor of activated T cells (NFAT) was first identified more than two decades ago as a major stimulation-responsive DNA-binding factor and transcriptional regulator in T cells. NFAT is a family of transcription factors. It was originally discovered in activated T cells as a transcription factor capable of binding to the promoter of human interleukin-2 (IL2) to rapidly induce its expression. Widely expressed in a variety of animal tissues and cells, NFAT is a key regulatory point of multiple intracellular signal transduction pathways, and also plays an important role in immune system, nervous system development, axon growth, and nervous system diseases，in this project it used to indirectly monitor effects of increases in the intracellular Ca2+ concentrations.[1]

Special design

In an effort to non-invasively assess the impact of elevated intracellular calcium ion (Ca2+) concentrations, we have developed a series of Ca2+-inducible NanoLuc reporters predicated on the Ca2+-dependent activation of dimeric nuclear factor of activated T cells (NFAT), as depicted in Figure 1[2].
These reporters incorporate a varying number of tandem repeats (1×, 5×, 6×, and 7×) of a pseudo-palindromic NFAT response element (NFAT-RE) derived from the interleukin-4 (IL4) promoter sequence (5′-GGAATTTCC-3′), which is anticipated to drive the transcription of the NanoLuc reporter gene. (Figure 1)
To elucidate the effects of intracellular Ca2+ concentration increments, human embryonic kidney 293 cells (HEK293) were co-transfected with expression plasmids encoding each of the newly designed NanoLuc reporters. This approach enables the indirect monitoring of the cellular response to fluctuations in intracellular Ca2+ concentrations.[3]

Figure 1. Construction of a pseudo-palindromic NFAT-response element (RE)-directed nanoluciferase(Nanoluc) reporter system.

Function test

In order to test the function of calcium ion response element, Pmin_7*NFAT promoter is loaded onto a vector which is equipped with sleeping beauty transposon site and nano luciferase (Nluc) reporter gene downstream. Once the fluorescent signal of Nluc expression be detected, this marks the successful binding of calcium ions and Pmin_7*NFAT promoter. (Figure 2) In Figure 2, we can find that the expression level of Nluc gene in cells supplemented with Pmin_7*NFAT promoter is significantly increased compared with the blank control, which proves that the calcium pathway responded successfully.

In Figure 2, we can find that the expression level of Nluc gene in cells supplemented with Pmin_7*NFAT promoter is significantly increased compared with the blank control, which proves that the calcium pathway responded successfully.

Sequence

Top:
ggagtacattggaaaattttatacacgttctagctacattggaaaattttatacacgttctagctacattggaaaatttt
atacacgttctagctacattggaaaattttatacacgttctagctacattggaaaattttatacacgttagaccctagag
ggtatataatggaagctcgacttccagtact

Reference

[1] M. R. Müller and A. Rao, “NFAT, immunity and cancer: a transcription factor comes of age,” Nat. Rev. Immunol., vol. 10, no. 9, pp. 645–656, Sep. 2010, doi: 10.1038/nri2818.
[2] W. Zhang, T. Takahara, T. Achiha, H. Shibata, and M. Maki, “Nanoluciferase Reporter Gene System Directed by Tandemly Repeated Pseudo-Palindromic NFAT-Response Elements Facilitates Analysis of Biological Endpoint Effects of Cellular Ca2+ Mobilization,” Int. J. Mol. Sci., vol. 19, no. 2, p. 605, Feb. 2018, doi: 10.3390/ijms19020605.
[3] K. A. Strait, P. K. Stricklett, R. M. Kohan, and D. E. Kohan, “Identification of Two Nuclear Factor of Activated T-cells (NFAT)-response Elements in the 5′-Upstream Regulatory Region of the ET-1 Promoter,” J. Biol. Chem., vol. 285, no. 37, pp. 28520–28528, Sep. 2010, doi: 10.1074/jbc.M110.153189.

@@ Line 9: / Line 9: @@
 <!-- -->
 <span class='h3bb'>Sequence and Features</span>
-<partinfo>BBa_K5267008 SequenceAndFeatures</partinfo>
+<partinfo>BBa_K5267010 SequenceAndFeatures</partinfo>
 <!-- Uncomment this to enable Functional Parameter display
 ===Functional Parameters===
-<partinfo>BBa_K5267008 parameters</partinfo>
+<partinfo>BBa_K5267010 parameters</partinfo>
 <!-- -->
 ===Profile===
 Name: Pmin_7*NFAT promoter
-<br>Base Pairs: 191bp
+<br>Base Pairs: 249bp
 <br>Origin: Homo sapiens
 <br>Properties: Transpose and respond to calcium ion signals
@@ Line 31: / Line 31: @@
 ===Special design===
-In an effort to non-invasively assess the impact of elevated intracellular calcium ion (Ca2+) concentrations, we have developed a series of Ca2+-inducible NanoLuc reporters predicated on the Ca2+-dependent activation of dimeric nuclear factor of activated T cells (NFAT), as depicted in Figure 1A[2].
+In an effort to non-invasively assess the impact of elevated intracellular calcium ion (Ca2+) concentrations, we have developed a series of Ca2+-inducible NanoLuc reporters predicated on the Ca2+-dependent activation of dimeric nuclear factor of activated T cells (NFAT), as depicted in Figure 1[2].
 <br>These reporters incorporate a varying number of tandem repeats (1×, 5×, 6×, and 7×) of a pseudo-palindromic NFAT response element (NFAT-RE) derived from the interleukin-4 (IL4) promoter sequence (5′-GGAATTTCC-3′), which is anticipated to drive the transcription of the NanoLuc reporter gene. '''(Figure 1)'''
 <br>To elucidate the effects of intracellular Ca2+ concentration increments, human embryonic kidney 293 cells (HEK293) were co-transfected with expression plasmids encoding each of the newly designed NanoLuc reporters. This approach enables the indirect monitoring of the cellular response to fluctuations in intracellular Ca2+ concentrations.[3]