Difference between revisions of "Part:BBa K5267006"

 
Line 3: Line 3:
 
<partinfo>BBa_K5267006 short</partinfo>
 
<partinfo>BBa_K5267006 short</partinfo>
  
−
cAMP Response Element (CRE) is a DNA sequence found in the promoter regions of many genes. It functions as a binding site for cAMP Response Element Binding Protein (CREB).CRE serves as a regulatory element that CREB binds to in the presence of elevated cAMP (cyclic adenosine monophosphate) levels, which are triggered by various signaling pathways. This binding regulates gene expression by promoting or inhibiting transcription.
+
As the response element to report whether melatonin is accepted or not
−
 
+
 
<!-- Add more about the biology of this part here
 
<!-- Add more about the biology of this part here
 
===Usage and Biology===
 
===Usage and Biology===
Line 17: Line 16:
 
<partinfo>BBa_K5267006 parameters</partinfo>
 
<partinfo>BBa_K5267006 parameters</partinfo>
 
<!-- -->
 
<!-- -->
 +
 +
===Profile===
 +
Name: 6xCRE-Pmin
 +
<br>Base Pairs: 117bp
 +
<br>Origin: Homo sapiens
 +
<br>Properties: As the response element to report whether melatonin is accepted or not
 +
 +
 +
===Usage and Biology===
 +
CRE(cAMP response element)play an important role as the binding site of CREB(cAMP response element binding protein) ,which is typically found within 100 nucleotides of the TATA Box. CREB binds to cAMP response elements and recruits transcriptional coactivators (such as CBP/p300) to form transcription complexes that initiate transcription of target genes.<sup>[1]</sup>.CREB activity is regulated by a variety of signaling pathways, including three downstream pathways activated by melatonin receptor MT1/2 in response to the action of melatonin: cAMP/PKA pathway, Ca2+ signal pathway, and MAPK/ERK pathway.<sup>[2]</sup>. Therefore, CRE can be used as one of the elements to test whether the downstream pathway of melatonin responds successfully.
 +
<br>TATA Box is one of the components that constitute the promoter of eukaryotes. The consistent order is TATA(A/T)A(A/T) (non-template chain sequence). It is about -30bp (-25~-32bp) upstream of the transcription starting point of most eukaryotic genes, and is basically composed of A-T base pairs, which determines the selection of gene transcription and is one of the binding sites of RNA polymerase. RNA polymerase can only start transcription after firmly binding to the TATA Box. The ability of CRE sequences to mediate transcriptional activation in response to cAMP appears to be somewhat promoter dependen<sup>[1]</sup>, in this experiment, TATA box of the commonly used CMV promoter was selected to minimize to the minimum amount of nucleotides for transcription and named Pmin.
 +
 +
 +
===Special design===
 +
This basic part is an important element for testing whether the downstream pathway of melatonin responds successfully. At present, the commonly used method to study the signaling pathway is to clone the response element of the transcription factor corresponding to the signaling pathway into the luciferase reporter gene vector, that is, pCRE-luc<sup>[1]</sup>, However, the expression effect of a single responder is weak, so multiple tandem repeats of the same responder element are usually inserted upstream of the reporter gene (the 5 '-UTR region) to enhance the activation of the signaling pathway. This original is the use of CRE clone four times combined with pmin plasmid construction.
 +
 +
 +
===Function test===
 +
In order to test the function of cAMP response element, multiple CRE sequences and Pmin were loaded onto vector that equipped with sleeping beauty transposon site, where IgK-Nluc reporter gene added downstream. If the incandescent sequence responds successfully, the Nluc gene will be successfully expressed. '''(Figure 1)'''
 +
<br>In Figure 1,we can find that the expression level of Nluc gene in cells supplemented with 4XGRE-Pmin was significantly increased compared with the blank control, which proved that the CRE sequence responded successfully.
 +
 +
 +
===Sequence===
 +
Top:
 +
<br>agcctgacgtccgagagccgtagcctgacgtccgagggtaccagcctgacgtccgagagccgtagcctgacgtccgagtactccgtagaggg
 +
<br>tatataatggaagctcgacttccag
 +
 +
 +
===Reference===
 +
[1] M. Montminy, "Transcriptional regulation by cyclic AMP," Annu Rev Biochem, vol. 66, pp. 807-22, 1997, doi: 10.1146/annurev.biochem.66.1.807.
 +
<br>[2] A. J. Shaywitz and M. E. Greenberg, "CREB: a stimulus-induced transcription factor activated by a diverse array of extracellular signals," Annu Rev Biochem, vol. 68, pp. 821-61, 1999, doi: 10.1146/annurev.biochem.68.1.821.
 +
<br>[3] C. Kemmer, D. A. Fluri, U. Witschi, A. Passeraub, A. Gutzwiller, and M. Fussenegger, "A designer network coordinating bovine artificial insemination by ovulation-triggered release of implanted sperms," J Control Release, vol. 150, no. 1, pp. 23-9, Feb 28 2011, doi: 10.1016/j.jconrel.2010.11.016.

Revision as of 09:44, 24 September 2024


6xCRE-Pmin

As the response element to report whether melatonin is accepted or not Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    INCOMPATIBLE WITH RFC[21]
    Illegal BglII site found at 118
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    COMPATIBLE WITH RFC[1000]


Profile

Name: 6xCRE-Pmin
Base Pairs: 117bp
Origin: Homo sapiens
Properties: As the response element to report whether melatonin is accepted or not


Usage and Biology

CRE(cAMP response element)play an important role as the binding site of CREB(cAMP response element binding protein) ,which is typically found within 100 nucleotides of the TATA Box. CREB binds to cAMP response elements and recruits transcriptional coactivators (such as CBP/p300) to form transcription complexes that initiate transcription of target genes.[1].CREB activity is regulated by a variety of signaling pathways, including three downstream pathways activated by melatonin receptor MT1/2 in response to the action of melatonin: cAMP/PKA pathway, Ca2+ signal pathway, and MAPK/ERK pathway.[2]. Therefore, CRE can be used as one of the elements to test whether the downstream pathway of melatonin responds successfully.
TATA Box is one of the components that constitute the promoter of eukaryotes. The consistent order is TATA(A/T)A(A/T) (non-template chain sequence). It is about -30bp (-25~-32bp) upstream of the transcription starting point of most eukaryotic genes, and is basically composed of A-T base pairs, which determines the selection of gene transcription and is one of the binding sites of RNA polymerase. RNA polymerase can only start transcription after firmly binding to the TATA Box. The ability of CRE sequences to mediate transcriptional activation in response to cAMP appears to be somewhat promoter dependen[1], in this experiment, TATA box of the commonly used CMV promoter was selected to minimize to the minimum amount of nucleotides for transcription and named Pmin.


Special design

This basic part is an important element for testing whether the downstream pathway of melatonin responds successfully. At present, the commonly used method to study the signaling pathway is to clone the response element of the transcription factor corresponding to the signaling pathway into the luciferase reporter gene vector, that is, pCRE-luc[1], However, the expression effect of a single responder is weak, so multiple tandem repeats of the same responder element are usually inserted upstream of the reporter gene (the 5 '-UTR region) to enhance the activation of the signaling pathway. This original is the use of CRE clone four times combined with pmin plasmid construction.


Function test

In order to test the function of cAMP response element, multiple CRE sequences and Pmin were loaded onto vector that equipped with sleeping beauty transposon site, where IgK-Nluc reporter gene added downstream. If the incandescent sequence responds successfully, the Nluc gene will be successfully expressed. (Figure 1)
In Figure 1,we can find that the expression level of Nluc gene in cells supplemented with 4XGRE-Pmin was significantly increased compared with the blank control, which proved that the CRE sequence responded successfully.


Sequence

Top:
agcctgacgtccgagagccgtagcctgacgtccgagggtaccagcctgacgtccgagagccgtagcctgacgtccgagtactccgtagaggg
tatataatggaagctcgacttccag


Reference

[1] M. Montminy, "Transcriptional regulation by cyclic AMP," Annu Rev Biochem, vol. 66, pp. 807-22, 1997, doi: 10.1146/annurev.biochem.66.1.807.
[2] A. J. Shaywitz and M. E. Greenberg, "CREB: a stimulus-induced transcription factor activated by a diverse array of extracellular signals," Annu Rev Biochem, vol. 68, pp. 821-61, 1999, doi: 10.1146/annurev.biochem.68.1.821.
[3] C. Kemmer, D. A. Fluri, U. Witschi, A. Passeraub, A. Gutzwiller, and M. Fussenegger, "A designer network coordinating bovine artificial insemination by ovulation-triggered release of implanted sperms," J Control Release, vol. 150, no. 1, pp. 23-9, Feb 28 2011, doi: 10.1016/j.jconrel.2010.11.016.