Difference between revisions of "Part:BBa K5143025"

Line 7: Line 7:
 
     <h1>Description</h1>
 
     <h1>Description</h1>
 
     <p>
 
     <p>
         Cp19k-MaSp1 is a fused protein that can be used as a bioglue. It is the result of a fusion between a spider silk protein (MaSp1) and the barnacle cement protein (Cp19k). The adhesion ability of Cp19k-MaSp1 was higher than that of individual proteins. Adhesion strength: 39.9.7 mJ/
+
         This part was designed to be used in Saccharomyces cerevisiae. Its main component are fwYellow (<a href="https://parts.igem.org/Part:BBa_K5143023">BBa_K5143023</a>) and Cp19k-MaSp1 (<a href="https://parts.igem.org/Part:BBa_K5143022">BBa_K5143022</a>) fused together (<a href="https://parts.igem.org/Part:BBa_K5143024">BBa_K5143024</a>) .By digesting this part with XhoI, the linearize fragment could be transformed in the yeast in order to recombinate with the Ura locus in S. cerevisiae BY4741 strain. Then, the yeast will express the alphafactor-fwYellow-CBD gene and the alphafactor-MaSp1-CBD gene. In our project, these two proteins will be secreted by the yeast and will bind to the cellulose (thanks to the fused CBD) in order to functionalize the cellulose.
 +
 
 
     </p>
 
     </p>
 
     <img src="https://static.igem.wiki/teams/5143/cp19k-masp1-bba-k5143003.png" width="400" alt="Cp19k-MaSp1">
 
     <img src="https://static.igem.wiki/teams/5143/cp19k-masp1-bba-k5143003.png" width="400" alt="Cp19k-MaSp1">

Revision as of 14:22, 21 September 2024


Plasmid D

</head> <body>

Description

This part was designed to be used in Saccharomyces cerevisiae. Its main component are fwYellow (<a href="https://parts.igem.org/Part:BBa_K5143023">BBa_K5143023</a>) and Cp19k-MaSp1 (<a href="https://parts.igem.org/Part:BBa_K5143022">BBa_K5143022</a>) fused together (<a href="https://parts.igem.org/Part:BBa_K5143024">BBa_K5143024</a>) .By digesting this part with XhoI, the linearize fragment could be transformed in the yeast in order to recombinate with the Ura locus in S. cerevisiae BY4741 strain. Then, the yeast will express the alphafactor-fwYellow-CBD gene and the alphafactor-MaSp1-CBD gene. In our project, these two proteins will be secreted by the yeast and will bind to the cellulose (thanks to the fused CBD) in order to functionalize the cellulose.

   <img src="cp19k-masp1-bba-k5143003.png" width="400" alt="Cp19k-MaSp1">

Construction

The codons were optimised for synthesis and expression in Saccharomyces cerevisiae .
MaSp1 and Cp19k are fused with the GS linker: GGGGGTGGTGGTTTGGAAAGTGGAGGAGGTGGAAGT
This composite part is part of the following larger composite part: <a href="https://parts.igem.org/Part:BBa_K5143024">BBa_K5143024</a>
It was synthesized in its entirety and then cloned via PCR into the following plasmid: <a href="https://parts.igem.org/Part:BBa_K5143005" target="_blank">BBa_K5143005</a>

References

Ye L, Liu X, Li K, Li X, Zhu J, Yang S, Xu L, Yang M, Yan Y, Yan J. A bioinspired synthetic fused protein adhesive from barnacle cement and spider dragline for potential biomedical materials. Int J Biol Macromol. 2023 Dec 31;253(Pt 5):127125. doi: <a href="https://doi.org/10.1016/j.ijbiomac.2023.127125" target="_blank">10.1016/j.ijbiomac.2023.127125</a>. Epub 2023 Sep 28. PMID: 37776922.

</body> </html>

Sequence and Features


Assembly Compatibility:
  • 10
    INCOMPATIBLE WITH RFC[10]
    Illegal PstI site found at 746
    Illegal PstI site found at 1049
    Illegal PstI site found at 1142
    Illegal PstI site found at 1148
  • 12
    INCOMPATIBLE WITH RFC[12]
    Illegal PstI site found at 746
    Illegal PstI site found at 1049
    Illegal PstI site found at 1142
    Illegal PstI site found at 1148
  • 21
    INCOMPATIBLE WITH RFC[21]
    Illegal BamHI site found at 577
  • 23
    INCOMPATIBLE WITH RFC[23]
    Illegal PstI site found at 746
    Illegal PstI site found at 1049
    Illegal PstI site found at 1142
    Illegal PstI site found at 1148
  • 25
    INCOMPATIBLE WITH RFC[25]
    Illegal PstI site found at 746
    Illegal PstI site found at 1049
    Illegal PstI site found at 1142
    Illegal PstI site found at 1148
  • 1000
    COMPATIBLE WITH RFC[1000]