Difference between revisions of "Part:BBa K5143003"
| Line 6: | Line 6: | ||
The codons were optimised for synthesis and expression in Saccharomyces cerevisiae. | The codons were optimised for synthesis and expression in Saccharomyces cerevisiae. | ||
MaSp1 and Cp19k are fused with the GS linker : GGGGGTGGTGGTTTGGAAAGTGGAGGAGGTGGAAGT | MaSp1 and Cp19k are fused with the GS linker : GGGGGTGGTGGTTTGGAAAGTGGAGGAGGTGGAAGT | ||
| − | This composite part is part of the following larger composite part: put name composite | + | This composite part is part of the following larger composite part: put name composite part |
| − | It was synthesized in its entirety and then cloned via PCR into the following plasmid: | + | It was synthesized in its entirety and then cloned via PCR into the following plasmid: [https://parts.igem.org/Part:BBa_K5143005 BBa_K5143005] |
| − | |||
| − | |||
| − | |||
References : | References : | ||
Ye L, Liu X, Li K, Li X, Zhu J, Yang S, Xu L, Yang M, Yan Y, Yan J. A bioinspired synthetic fused protein adhesive from barnacle cement and spider dragline for potential biomedical materials. Int J Biol Macromol. 2023 Dec 31;253(Pt 5):127125. doi: 10.1016/j.ijbiomac.2023.127125. Epub 2023 Sep 28. PMID: 37776922. | Ye L, Liu X, Li K, Li X, Zhu J, Yang S, Xu L, Yang M, Yan Y, Yan J. A bioinspired synthetic fused protein adhesive from barnacle cement and spider dragline for potential biomedical materials. Int J Biol Macromol. 2023 Dec 31;253(Pt 5):127125. doi: 10.1016/j.ijbiomac.2023.127125. Epub 2023 Sep 28. PMID: 37776922. | ||
Revision as of 15:59, 29 July 2024
Description : MaSp1-Cp19k is a fused protein that can be used as a bioglue. It is the result of a fusion between a spider silk protein (MaSp1) and the barnacle cement protein (Cp19k). The adhesion ability of cp19k-MaSp1 was higher than that of individual proteins. Adhesion strenght : 39.9.7 mJ/m²
Construction :
The codons were optimised for synthesis and expression in Saccharomyces cerevisiae.
MaSp1 and Cp19k are fused with the GS linker : GGGGGTGGTGGTTTGGAAAGTGGAGGAGGTGGAAGT
This composite part is part of the following larger composite part: put name composite part
It was synthesized in its entirety and then cloned via PCR into the following plasmid: BBa_K5143005
References :
Ye L, Liu X, Li K, Li X, Zhu J, Yang S, Xu L, Yang M, Yan Y, Yan J. A bioinspired synthetic fused protein adhesive from barnacle cement and spider dragline for potential biomedical materials. Int J Biol Macromol. 2023 Dec 31;253(Pt 5):127125. doi: 10.1016/j.ijbiomac.2023.127125. Epub 2023 Sep 28. PMID: 37776922.