Difference between revisions of "Part:BBa K5133004"
Line 94: Line 94:
 
<font size=4><b>Step 1: molecular cloning</b></font>
 
<font size=4><b>Step 1: molecular cloning</b></font>
  
−
To construct this part, we first need to aquire the linearized DNA fragments of both vector and inserted fragments. Thus, we amplified vector pSB1C3 and inseted fragment (from plasmid pJL1) using PCR. Results of agarose gel electrophoresis showing the desired DNA bands (<b>Figure 4</b>) as pSB1C3 (2070 bp) and inserted fragment (988 bp).
+
To construct this part, we first need to acquire the linearized DNA fragments of both vector and inserted fragments. Thus, we amplified vector pSB1C3 and inserted fragments by using PCR. Results of agarose gel electrophoresis showing the desired DNA bands (<b>Figure 4</b>) as pSB1C3 (2070 bp) and inserted fragment (988 bp) used in this construction.
  
  
Line 117: Line 117:
  
  
−
<center><b>Figure 4. Agarose gel electrophoresis analysis of PCR products. The bands indicate one vector pSB1C3 and three inserted frangents. The first inserted fragment band of BBa_K5133004 (988 bp) is used for the construction of this composite part, while the other two inserted fragment bands are used for <bbpart>BBa_K5133006</bbpart> and <bbpart>BBa_K5133008</bbpart>, respectively</b></center>
+
<center><b>Figure 4. Agarose gel electrophoresis analysis of PCR products for molecular cloning. The DNA bands indicate one vector pSB1C3 and three inserted frangents. The first inserted fragment of BBa_K5133004 (988 bp) is used for the construction of this composite part, while the other two inserted fragments are used for <bbpart>BBa_K5133006</bbpart> and <bbpart>BBa_K5133008</bbpart>, respectively.</b></center>
 +
 
 +
 
 +
 
 +
 
 +
When we got the purified DNA products, then we assembled these fragments by using Gibson Assembly strategy<sup>[3]</sup>. Next, we transformed the reaction to competent <i>E. coli</i> Mach1-T1 cells and spread the transformants onto LB-agar plates containing 34µg/mL chloramphenicol. As shown in <b>Figure 5</b>, the <i>E. coli</i> transformants could normally grew on LB-agar plates and be used for the following experiments.
 +
 
 +
 
 +
<center>
 +
<html lang="en">
 +
<head>
 +
    <meta charset="UTF-8">
 +
    <meta name="viewport" content="width=device-width, initial-scale=1.0">
 +
    <title>Resizable Image</title>
 +
    <style>
 +
        .resizable-img5 {
 +
            max-width: 60%;
 +
            height: auto;
 +
        }
 +
    </style>
 +
</head>
 +
<body>
 +
    <img src="https://static.igem.wiki/teams/5133/bba-k5133004-4.jpg"  class="resizable-img5">
 +
</body>
 +
</html>
 +
</center>
 +
 
 +
 
 +
<center><b>Figure 5. <i>E. coli</i> Mach1-T1 transformants on LB-agar plates, showing the expected phenotype refer to the construction of this part.</b></center>
  
  
Line 145: Line 173:
  
 
[1] https://www.addgene.org/69496/
 
[1] https://www.addgene.org/69496/
−
 
  
 
[2] Ba, F. et al. Expanding the toolbox of probiotic <i>Escherichia coli</i> Nissle 1917 for synthetic biology. <b>Biotechnology Journal</b> 19, 2300327 (2024). doi: 10.1002/biot.202300327
 
[2] Ba, F. et al. Expanding the toolbox of probiotic <i>Escherichia coli</i> Nissle 1917 for synthetic biology. <b>Biotechnology Journal</b> 19, 2300327 (2024). doi: 10.1002/biot.202300327
 +
 +
[3] Gibson, D.G. et al. Enzymatic assembly of DNA molecules up to several hundred kilobases. <b>Nature Methods</b> 6, 343-345 (2009). doi: 10.1038/nmeth.1318
  
  

Revision as of 13:01, 29 July 2024


sfGFP generator for CFPS (cell-free protein synthesis)

Group: GEC-China (iGEM 2024, team number: #5133)


Introduction

This composite part is derived from plasmid pJL1 (Addgene: #69496)[1], consisting of four basic parts: T7 promoter (BBa_K5133000), ribosome binding site (RBS, BBa_K5133001), coding sequence of superfolder green fluorescent protein (sfGFP, BBa_K5133002), and T7 terminator (BBa_K5133003)(Figures 1, 2). The plasmid pJL1 is commonly used for the in vitro sfGFP expression of cell-free protein synthesis (CFPS)[2], however, an iGEM-standarized CFPS construction has not yet been commonly reported and characterized yet. Hence, this part is established to demonstrate the feasibility of CFPS in our project.


Resizable Image


Figure 1. Schematic design of this part, generated by SnapGene.




Resizable Image


Figure 2. Detailed constitute of this composite part, including four basic parts: T7 promoter (BBa_K5133000), RBS (BBa_K5133001), sfGFP (BBa_K5133002), and T7 terminator (BBa_K5133003).


Results

For the characterization process of this part, follow five steps showing in Figure 3: (1) molecular cloning; (2) colony PCR; (3) sequencing; (4) plasmid extraction; (5) CFPS reaction.


Resizable Image


Figure 3. Workflow for the construction and characterization of this part.



Step 1: molecular cloning

To construct this part, we first need to acquire the linearized DNA fragments of both vector and inserted fragments. Thus, we amplified vector pSB1C3 and inserted fragments by using PCR. Results of agarose gel electrophoresis showing the desired DNA bands (Figure 4) as pSB1C3 (2070 bp) and inserted fragment (988 bp) used in this construction.


Resizable Image


Figure 4. Agarose gel electrophoresis analysis of PCR products for molecular cloning. The DNA bands indicate one vector pSB1C3 and three inserted frangents. The first inserted fragment of BBa_K5133004 (988 bp) is used for the construction of this composite part, while the other two inserted fragments are used for BBa_K5133006 and BBa_K5133008, respectively.



When we got the purified DNA products, then we assembled these fragments by using Gibson Assembly strategy[3]. Next, we transformed the reaction to competent E. coli Mach1-T1 cells and spread the transformants onto LB-agar plates containing 34µg/mL chloramphenicol. As shown in Figure 5, the E. coli transformants could normally grew on LB-agar plates and be used for the following experiments.


Resizable Image


Figure 5. E. coli Mach1-T1 transformants on LB-agar plates, showing the expected phenotype refer to the construction of this part.




Usages

This part is used for the construction of composite part BBa_K5133004 (sfGFP generator) to demonstrate the feasibility of CFPS in our project. Please see the detailed experimental results in BBa_K5133004.


DNA sequence (from 5' to 3')

atgagcaaaggtgaagaactgtttaccggcgttgtgccgattctggtggaactggatggcgatgtgaacggtcacaaattcagcgtgcgtggtgaaggtgaaggcgatgccacgattggcaaactgacgctgaaattt atctgcaccaccggcaaactgccggtgccgtggccgacgctggtgaccaccctgacctatggcgttcagtgttttagtcgctatccggatcacatgaaacgtcacgatttctttaaatctgcaatgccggaaggctat gtgcaggaacgtacgattagctttaaagatgatggcaaatataaaacgcgcgccgttgtgaaatttgaaggcgataccctggtgaaccgcattgaactgaaaggcacggattttaaagaagatggcaatatcctgggc cataaactggaatacaactttaatagccataatgtttatattacggcggataaacagaaaaatggcatcaaagcgaattttaccgttcgccataacgttgaagatggcagtgtgcagctggcagatcattatcagcag aataccccgattggtgatggtccggtgctgctgccggataatcattatctgagcacgcagaccgttctgtctaaagatccgaacgaaaaaggcacgcgggaccacatggttctgcacgaatatgtgaatgcggcaggt attacgtggagccatccgcagttcgaaaaataa

Red font: Strep-Tag II, from pJL1[1]


References

[1] https://www.addgene.org/69496/

[2] Ba, F. et al. Expanding the toolbox of probiotic Escherichia coli Nissle 1917 for synthetic biology. Biotechnology Journal 19, 2300327 (2024). doi: 10.1002/biot.202300327

[3] Gibson, D.G. et al. Enzymatic assembly of DNA molecules up to several hundred kilobases. Nature Methods 6, 343-345 (2009). doi: 10.1038/nmeth.1318



Sequence and Features


Assembly Compatibility:
  • 10
    INCOMPATIBLE WITH RFC[10]
    Illegal XbaI site found at 51
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    INCOMPATIBLE WITH RFC[23]
    Illegal XbaI site found at 51
  • 25
    INCOMPATIBLE WITH RFC[25]
    Illegal XbaI site found at 51
  • 1000
    INCOMPATIBLE WITH RFC[1000]
    Illegal BsaI.rc site found at 32