Difference between revisions of "Part:BBa K5133000"

Revision as of 03:42, 27 July 2024

T7 promoter (from plasmid pJL1)

Group: GEC-China (iGEM 2024, team number: #5133)

This basic part is derived from plasmid pJL1 (Addgene: #69496)^[1], including a conserved DNA sequence of T7 promoter as 5'-taatacgactcactatagggaga-3'^[2]. The plasmid pJL1 is commonly used for the sfGFP expression for cell-free protein synthesis (CFPS). Hence, this part is used for the construction of three composite parts: BBa_K5133004 (sfGFP generator), BBa_K5133006 (Microcin H47 generator), and BBa_K5133008 (Microcin M generator), for CFPS in our project.

Design and characterization

The plasmid design of this bilogical part is shown as Figure 1, assembled with iGEM standard backbone pSB1C3. Results of Sanger sequencing showing the correct construction of this part (Figure 2).

Figure 1. Design of basic part BBa_K5133000, generated by SnapGene.

Usages

This part is used for the construction of three composite parts: BBa_K5133004 (sfGFP generator), BBa_K5133006 (Microcin H47 generator), and BBa_K5133008 (Microcin M generator), for CFPS in our project.

DNA sequence (from 5' to 3')

atcccgcgaaattaatacgactcactatagggagaccacaacggtttccctctagaaataattttgtttaacttt

References

[1]XXX

[2]XXX

Sequence and Features