Difference between revisions of "Part:BBa K5133000"
Line 9: | Line 9: | ||
+ | ==<b>Design and characterization</b>== | ||
+ | |||
+ | The plasmid design of this bilogical part is shown as <b>Figure 1</b>, assembled with iGEM standard backbone <bbpart>pSB1C3</bbpart>. Results of Sanger sequencing showing the correct construction of this part (<b>Figure 2</b>). | ||
+ | |||
+ | [[File:T--Shanghaitech--lasrfx.jpg|thumb|center|700px|<b>Fig. 1 Genetic Circuit Design</b>]] | ||
+ | |||
+ | [[File:T--Shanghaitech--lasrfx.jpg|thumb|center|700px|<b>Fig. 1 Genetic Circuit Design</b>]] | ||
+ | |||
+ | ==<b>Usages</b>== | ||
+ | |||
+ | This part is used for the construction of three composite parts: <bbpart>BBa_K5133004</bbpart> (sfGFP generator), <bbpart>BBa_K5133006</bbpart> (Microcin H47 generator), and <bbpart>BBa_K5133008</bbpart> (Microcin M generator), for CFPS in our project. | ||
+ | |||
+ | |||
+ | ==<b>DNA sequence (from 5' to 3')</b>== | ||
+ | |||
+ | atcccgcgaaattaatacgactcactatagggagaccacaacggtttccctctagaaataattttgtttaacttt | ||
+ | |||
+ | ==<b>References</b>== | ||
+ | |||
+ | [1]XXX | ||
+ | |||
+ | [2]XXX | ||
Revision as of 03:00, 27 July 2024
T7 promoter (from plasmid pJL1)
Group: GEC-China (iGEM 2024, team number: #5133)
This basic part is derived from plasmid pJL1 (Addgene: #69496)[1], including a conserved DNA sequence of T7 promoter as 5'-taatacgactcactatagggaga-3'[2]. The plasmid pJL1 is commonly used for the sfGFP expression for cell-free protein synthesis (CFPS). Hence, this part is used for the construction of three composite parts: BBa_K5133004 (sfGFP generator), BBa_K5133006 (Microcin H47 generator), and BBa_K5133008 (Microcin M generator), for CFPS in our project.
Design and characterization
The plasmid design of this bilogical part is shown as Figure 1, assembled with iGEM standard backbone pSB1C3. Results of Sanger sequencing showing the correct construction of this part (Figure 2).
Usages
This part is used for the construction of three composite parts: BBa_K5133004 (sfGFP generator), BBa_K5133006 (Microcin H47 generator), and BBa_K5133008 (Microcin M generator), for CFPS in our project.
DNA sequence (from 5' to 3')
atcccgcgaaattaatacgactcactatagggagaccacaacggtttccctctagaaataattttgtttaacttt
References
[1]XXX
[2]XXX
Sequence and Features
- 10INCOMPATIBLE WITH RFC[10]Illegal XbaI site found at 51
- 12COMPATIBLE WITH RFC[12]
- 21COMPATIBLE WITH RFC[21]
- 23INCOMPATIBLE WITH RFC[23]Illegal XbaI site found at 51
- 25INCOMPATIBLE WITH RFC[25]Illegal XbaI site found at 51
- 1000INCOMPATIBLE WITH RFC[1000]Illegal BsaI.rc site found at 32