Difference between revisions of "Part:BBa K4634018"
NgSweeHong (Talk | contribs) |
NgSweeHong (Talk | contribs) |
||
Line 47: | Line 47: | ||
PL and PR promoter, which are ubiquitously employed in bacterial expression systems, are typical promoters regulated by temperature and . In pBV220, they are located tandemly. The repressor, Tcl857, is a temperature sensitive mutant of phage λ. Under normal condition, Tcl857 act as dimers that bind to the OR1, OR2 and OR3 operator site, hindering the occurrence of transcription. When the temperature rises to about 42 °C, the repressor is thus denatured and the transcription happens.[1] | PL and PR promoter, which are ubiquitously employed in bacterial expression systems, are typical promoters regulated by temperature and . In pBV220, they are located tandemly. The repressor, Tcl857, is a temperature sensitive mutant of phage λ. Under normal condition, Tcl857 act as dimers that bind to the OR1, OR2 and OR3 operator site, hindering the occurrence of transcription. When the temperature rises to about 42 °C, the repressor is thus denatured and the transcription happens.[1] | ||
− | Compared to PL wild type, the Temperature-sensitive promoter | + | Compared to PL wild type, the Temperature-sensitive promoter 2 (PL-2) shows a higher promoter activity after heat treatment. |
<br> | <br> |
Latest revision as of 14:06, 12 October 2023
Temperature-sensitive Promoter: pBV220_PL-2, modified from PL promoter.
pBV220_PL | |
---|---|
Function | Inducible promoter |
Chassis Tested | Escherichia coli (bacterial) |
Assembly Used | PCR |
Abstraction Hierarchy | Part |
Backbone | pBV220 |
Submitted by | Tsinghua iGEM 2023 |
Here we hope to optimize PL promoter, enabling a higher expression level at 42 °C. The following content mainly describes the pBV220_PL2 which shows prominent improvement during our experiment. Considering the completeness of the project, the nuclear acid sequence as well as corresponding experimental data of other promoters are also listed below.
Sequence and Features
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21COMPATIBLE WITH RFC[21]
- 23COMPATIBLE WITH RFC[23]
- 25COMPATIBLE WITH RFC[25]
- 1000COMPATIBLE WITH RFC[1000]
Usage and Biology
PL and PR promoter, which are ubiquitously employed in bacterial expression systems, are typical promoters regulated by temperature and . In pBV220, they are located tandemly. The repressor, Tcl857, is a temperature sensitive mutant of phage λ. Under normal condition, Tcl857 act as dimers that bind to the OR1, OR2 and OR3 operator site, hindering the occurrence of transcription. When the temperature rises to about 42 °C, the repressor is thus denatured and the transcription happens.[1] Compared to PL wild type, the Temperature-sensitive promoter 2 (PL-2) shows a higher promoter activity after heat treatment.Identifier | Sequence (5’ to 3’) |
---|---|
PL1 | gtaatcacctctgttataccggagatttgttagcctgagcacatcagcagg |
PL2 | gagcccattgcgcctttttggaatacccatgatactgagcacatcagcagg |
PL3 | aatttgcatctacaactccaagtatgaagcggtactgagcacatcagcagg |
PL4 | taacaccagcgggaagttgcctgtgtgcatcgcactgagcacatcagcagg |
PL5 | attatatgccgcacggactctgcggcgcaagatactgagcacatcagcagg |
Experimental Design
Promoter activity was tested as below:
To test the promoter activity, mCherry gene, which encoded a red fluorescent protein, were ligated downstream. Therefore, the fluorescence intensity would be used as an indicator to reflect the expression level.
Through PCR, The new designed sequence overwrote the PL wild type sequence. And the recombinant plasmids were subsequently transformed into chemically component BL-21 E.coli strain for expression. This cells were then amplified in liquid LB with ampicillin at 30 °C 220rpm overnight, and were diluted by 100 folds into LB liquid medium and further grown to log phase(OD600=0.4-0.6) the next day. Afterwards, the cells were divided into 7 groups, incubating at different temperature (39°C, 42°C) and heating time (60min, 90min and 120min) as well as a control group were adopted. Then, all bacteria are all placed at 37 °C for 12 hours. After two times of PBS washing, we re-suspend the cells in PBS. OD600 and Fluorescence intensity of mCherry was read and recorded using a plate reader. Promoter activity was reflected from fluorescence divided by OD of bacteria.
Results
Firstly, plasmids contains modified PL-promoter were constructed through PCR. During the amplification, The plasmid was divided into two parts (2.2 kb and 2.1 kb respectively) by 2 pairs of primers, and the results of agarose gel electrophoresis were shown below (Fig 1). The right position of sample DNA between makers indicated the success ligation of our PL.
Then, the products were ligated through infusion, and then transformed into DH-5α E.coli strain to amplify. A colony PCR was also performed (see fig 2), similarly, positive results were observed.
Moreover, the bacteria was also sent to biotechnology company for sequencing, and the returned data also demonstrated the correct construction of the recombinant plasmid.
After the transformation into BL-21 E.coli strain, we then evaluate the promoter activity. Fig 3A demonstrates the promoter activity between wild type PL and PL-2. Heat treatment was carried under 42 °C for 1.5h. PL-2 exhibited a significant expression fold (41.46x) increasing. Moreover, a mutation of PL-2 (drawn as PL-2*) was observed due to its extremely low promoter activity, which from a side also confirmed that the rational design of our software did work.
The expression level data was illustrated in figure 4. PL-2 showed stronger expression ability as a whole. The wild type PR possessed a significant activation of the promoter after 42 °C heat treatment, however, for the modified, although a clear trend of expression rising through temperature build-up was still clear, however, CI857, the repressor, seemed to lose its controllability on most modified PL under low temperature.
Moreover, the activity under 42°C, 1.5h treatment of the other 4 promoters designed was also tested. Results were shown in table 1 as well as figure 5:
Identifier | Sequence (5’ to 3’) |
---|---|
PL (wild type) | / |
PL1 | 2.07 |
PL2 | 41.46 |
PL3 | 0.98 |
PL4 | 1.36 |
PL5 | 2.75 |
Discussion and outlook
Most designed promoter exhibits higher expression level compared to original PL promoter, and the overall increasing validated the effect of our software. Among the promoters, PL-2 stood out as an excellent performed one.
We succeeded in improving the promoter expression under the condition of 42°C, however, almost all promoters exhibited even higher relative activity under 37°C, which lead to our conjecture that the our software weakened the repressor-promoter interaction. This may due to the conditional trigger of PL promoter activity, while in the training set, there were difference characteristics and variance of the promoters which contributed to our software learning.