Difference between revisions of "Part:BBa K4814009"

Line 8: Line 8:
 
The EYFP is derived from EYFP Sequence and Map (snapgene.com)(same as BBa_K4814010), a mammalian codon optimized EYFP.
 
The EYFP is derived from EYFP Sequence and Map (snapgene.com)(same as BBa_K4814010), a mammalian codon optimized EYFP.
  
 +
===RPA1-EYFP transfection===
 +
We successfully transfected this vector into HEK293 cells. According to the co-localization imaging (Fig. 1), the
 +
RPA1-EYFP protein mainly overlaps with the nucleus marked with Hoechst blue.
 +
<html>
 +
<img src="https://static.igem.wiki/teams/4814/wiki/lab/human/hek293-gfp-mcherry-gfp-mcherry-yfp-hoechst-overview-0913.png" style="width: 600px;">
 +
<p>Figure 1. The images of RPA1-EYFP location with Hoechst blue, DNA dye.</p>
 +
</html>
 +
 +
===UV treatment===
 +
We also treated cells with UVB to see if RPA1 concentrates at the nucleus when DNA is damaged. The fluorescence of EYFP did not show clusters.
 +
 +
<html>
 +
<img src="https://static.igem.wiki/teams/4814/wiki/lab/human/hek293-eyfp-uv-overview-0913.png" style="width: 600px;">
 +
<p>Figure 2. The images of RPA1-EYFP after UV treatment.</p>
 +
</html>
 +
 +
===FRET (C+Y)===
 
We transfected with ATRIP-ECFP and ATRIP-ECFP + RPA1-YFP (C+Y). However, due to time constraints images of the cells were taken in the six-well plate and the quality was slightly compromised. Nonetheless, these images still provide confirmation that both vectors were successfully transfected into the cells. The CFP fluorescence was excited at 405 nm and the YFP fluorescence was excited at 488 nm.
 
We transfected with ATRIP-ECFP and ATRIP-ECFP + RPA1-YFP (C+Y). However, due to time constraints images of the cells were taken in the six-well plate and the quality was slightly compromised. Nonetheless, these images still provide confirmation that both vectors were successfully transfected into the cells. The CFP fluorescence was excited at 405 nm and the YFP fluorescence was excited at 488 nm.
  
 
<html>
 
<html>
 
<img src="https://static.igem.wiki/teams/4814/wiki/lab/human/c-c-y-location-20230920.png" style="width: 600px;">
 
<img src="https://static.igem.wiki/teams/4814/wiki/lab/human/c-c-y-location-20230920.png" style="width: 600px;">
<p>Figure 1. The images of ATRIP-ECFP and ATRIP-ECFP + RPA1-EYFP (C+Y) on six-well plate.</p>
+
<p>Figure 2. The images of ATRIP-ECFP and ATRIP-ECFP + RPA1-EYFP (C+Y) on six-well plate.</p>
 
</html>
 
</html>
  

Revision as of 09:50, 12 October 2023

RPA1-EYFP

FRET is using fluorescent proteins as probes to detect the interaction of targeted proteins. The distance-dependent process transfers energy from an excited molecular fluorophore (the donor) to another fluorophore (the acceptor) through intermolecular long-range dipole–dipole coupling once the desired proteins bind (Sekar, R. B. and Periasamy, A., 2003). The critical Förster radius (typically 3-6 nm) at angstrom distances (10–100 Å) can be calculated to increase the accuracy and ensure precise energy transfer. (Alan Mulllan, n.d.) By using FRET, we can therefore observe the interaction of two proteins by measuring the lifetime of the fluorescent proteins attached to them.

As the aim of this design is to detect DNA damages in mammalian cells, we have used CMV promoter and the Lentivirus vector. Please refer to BBa_K4814004 and BBa_K4814005 (ATRIP and RPA1) for detailed explanation of the two proteins involved in the DNA damage checkpoint process.

The EYFP is derived from EYFP Sequence and Map (snapgene.com)(same as BBa_K4814010), a mammalian codon optimized EYFP.

RPA1-EYFP transfection

We successfully transfected this vector into HEK293 cells. According to the co-localization imaging (Fig. 1), the RPA1-EYFP protein mainly overlaps with the nucleus marked with Hoechst blue.

Figure 1. The images of RPA1-EYFP location with Hoechst blue, DNA dye.

UV treatment

We also treated cells with UVB to see if RPA1 concentrates at the nucleus when DNA is damaged. The fluorescence of EYFP did not show clusters.

Figure 2. The images of RPA1-EYFP after UV treatment.

FRET (C+Y)

We transfected with ATRIP-ECFP and ATRIP-ECFP + RPA1-YFP (C+Y). However, due to time constraints images of the cells were taken in the six-well plate and the quality was slightly compromised. Nonetheless, these images still provide confirmation that both vectors were successfully transfected into the cells. The CFP fluorescence was excited at 405 nm and the YFP fluorescence was excited at 488 nm.

Figure 2. The images of ATRIP-ECFP and ATRIP-ECFP + RPA1-EYFP (C+Y) on six-well plate.

Sekar, R. B., & Periasamy, A. (2003). Fluorescence resonance energy transfer (FRET) microscopy imaging of live cell protein localizations. The Journal of cell biology, 160(5), 629–633. https://doi.org/10.1083/jcb.200210140

Alan Mulllan. (n.d.). Advanced microscopy applications – an overview of FRET. OXFORD instruments. https://andor.oxinst.com/learning/view/article/fret

  • caagtttgtacaaaaaagcaggctgccacc contains Kozak (gccacc)


Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    INCOMPATIBLE WITH RFC[21]
    Illegal XhoI site found at 1606
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    INCOMPATIBLE WITH RFC[1000]
    Illegal BsaI.rc site found at 2419