Difference between revisions of "Part:BBa K4664002"

Latest revision as of 05:41, 12 October 2023

Padlock-miR-223

Padlock Padlock-miR-223 is the corresponding padlock chosen for the miR-223 biomarker.

Sequence and Features

Background

The padlock probe is essential to our experiments, especially the ligation and rolling circle amplification (RCA) steps. Both of these steps are included in the intermediary assays and our final MB-ERC2 (miRNA biomarker-based exponential RCP Cas12a/CRISPR) system. The general MB-ERC2 schematics is shown below in Figure 1.

Figure 1. MB-ERC2 Reaction Schematics.

Design

Padlock-223 is a 61 bp-long linear single-stranded DNA (ssDNA). It is composed of three sections: the miR-223 binding site (ligation module), crRNA recognition site (Cas12a detection module), and the intermediate sequence. Figure 2 is a visualisation of the padlock probe construct.

Figure 2. Padlock Probe Basic Construct
To optimise the Padlock-223 sequence, we performed experiments with single, double, and triple ligation module mismatches and alternating Cas12a detection module locations (Parts BBa_K4664007 to BBa_K4664023). For results of the optimization experiments, please see registry pages for BBa_K4664007 and BBa_K4664010.
We also performed a series of experiments, aiming to optimise our MB-ERC2 reaction system. These include experimenting with different concentrations of the various reagents used in the assay, trying out different reagents/buffers and buffer concentrations, and the role of RCA amplicon in secondary RCA initiation. More information on these could be found on our Experiments page.
The Cas12a detection module sequence is identical to the crRNA (aside from the difference in T and U). This is due to the crRNA’s complementarity to the RCA amplicon (product of DNA synthesis with the padlock as template). More information on crRNA could be found on the registry page for BBa_K4664005.
Sequence:
TCAAATACACGAGATACCCTAACCATCGATCGTCGCCGTCCAGCTCGACCAACTCAGCTTG

Results

Below are results from the various experiments involving Padlock-223. Figures 3-5 are the intermediary assays three-step and two-step. Figures 6-8 are results from our MB-ERC2 experiments. Figures 9-26 are results obtained from our set of optimisation trials.

Figure 3. Three step assay 500 fM, 100 fM, and 20 fM.

Figure 4. Two step assay 100 pM, 10 pM, and NC.

Figure 5. Two step assay 1 pM, 500 fM, 100 fM, and 20 fM (x-axis is 10-minute cycle).
Before we attempted a one-step, isothermal reaction system, we first tried tandem combinations of ligation, RCA and Cas12a (our intermediary assays experiments). Our first test trial was a three step assay (ligation-RCA-Cas12), lasting approximately 5-6 hours. After that, we attempted a two step method (with ligation and RCA jointly carried out instead of separately, as in the three step assay), which shortened the reaction time to 3-4 hours. Then, after both intermediary assays yielded satisfactory results (as shown in Figures 3-5), we began testing a one-step reaction.

Figure 6. MB-ERC2, 1 nM and 100 pM (x-axis is 10-minute cycle).

Figure 7. MB-ERC2 10 pM, 1 pM, and 500 fM.

Figure 8. MB-ERC2 100 fM and 20 fM.
After the success of our MB-ERC2 system (based on the EXTRA-CRISPR system devised by He et al. (2023)), we began a series of optimization experiments to investigate the effects of different concentration reagents/different reagents on reaction outcomes.

Phi 29 Poymerase

Phi29 polymerase is important in terms of facilitating the amplification in RCA (i.e. synthesis of the DNA strand complementary to the padlock). On the basis of our standard concentration (0.1 U/µl), we tested NC, 0.05 U/µl, 0.15 U/µl, 0.2 U/µl, and 0.5 U/µl

Figure 9. Phi 29 concentration 1 pM.

Figure 10. Phi 29 concentration 10 pM.

Figure 11. Phi 29 concentration final values.

Ribonucleoprotein (RNP)

Cas12a cleavages significantly influence the outcome of the reactions. Cis-cleavages are important for the initiation of secondary RCAs, thus promoting exponential amplification. Trans-cleavages are vital in terms of expression of the fluorescence signals. Thus, it is important to determine the optimal amount of RNP required to best enhance reaction kinetics. Our standard RNP concentration is 1 nM, thus, we tested the MB-ERC2 system with varied RNP concentrations of NC, 0.5 nM, 2.5 nM, 4 nM, and 5 nM.

Figure 12. RNP concentration 1 pM.

Figure 13. RNP concentration 10 pM.

Figure 14. RNP concentration final values.

Padlock Probe (PLP)

The PLP-reporter ratio is vital to the experiment outcome (see Experiments page, Cas12a section). Padlocks are essential in the step of rolling circle amplification (RCA). Starting from the standard 100 nM, we set up trials with PLP concentrations of NC, 50 nM, 75 nM, 150 nM, and 200 nM.

Figure 15. PLP concentration 1 pM.

Figure 16. PLP concentration 10 pM.

Figure 17. PLP concentration final values.

Reporter

Our reporter is composed of a fluorophore linked to a quencher molecule. While the two are connected, the quencher absorbs energy from the fluorophore, thus preventing it from emitting fluorescence. But when cas12a trans-cleavage acts on the quencher-fluorophore and severs their link, the fluorophore would start giving out fluorescence. PLP-reporter ratio is essential to the results of the assay reaction, moreover, reporters generate the fluorescence signals on which our analytical hardware is solely based. We investigated concentrations of 0.5 µM, 1 µM, 2 µM, and 5 µM (standard is 10 µM).

Figure 18. Reporter concentration 1 pM.

Figure 19. Reporter concentration 10 pM.

Figure 20. Reporter concentration final values.

SplintR and T4 ligases

According to Jin et al. (2016), SplintR ligase yields significantly better performance than T4 ligase. Thus, we designed this experiment, comparing 5 U/20 µl SplintR with 40 U/20 µl T4 ligase.

Figure 21. SplintR ligase vs. T4 ligase.

SplintR Ligase

SplintR ligase is extremely important for initiating the RCA process. We investigated concentrations of 10 U/20 µl, 20 U/20 µl, 25 U/20 µl, and 50 U/20 µl (standard 5 U/20 µl).

Figure 22. SplintR ligase concentration.

Figure 23. SplintR & T4 final values.

Bovine Serum Albumin Concentration

Different amounts of BSA were added to the reaction system. We used 0.1 mg/mL, 0.3 mg/mL, and 0.4 mg/mL (standard 0.2 mg/mL).

Figure 24. BSA concentration.

Buffer Optimization

We investigated the following buffer combinations: 1) Buffer 2.1 (NEB) + BSA; 2) SplintR buffer + BSA, and; 3) Phi29 buffer + BSA. The SplintR/BSA combination yielded the best results.

Figure 25. Buffer selection.

Synthetic Short-cuts

We created a synthetic short-cut (short amplicon), which anneals to the padlock and initiates secondary RCA reactions. The short-cuts were then put in place of miRNA into the reaction system.

Figure 26. Synthetic short-cuts.
Padlock-223 and the MB-ERC2 system represent significant progress in terms of COPD detection. The verified LOD is 20 fM, which is comparable to RT-qPCR, the ‘golden standard’ for miRNA detection (for our RT-qPCR results, please see BBa_K4664000). Moreover, reaction time was shortened to 20-100 minutes, and cost was cut down to $1 per reaction for reagents (see Contribution page). We also believe that the MB-ERC2 system is potentially applicable for the detection of other diseases with miRNA biomarkers.

References

Jin, J., Vaud, S., Zhelkovsky, A., Pósfai, J., & McReynolds, L. A. (2016). Sensitive and specific miRNA detection method using SplintR Ligase. Nucleic Acids Research, 44(13), e116. https://doi.org/10.1093/nar/gkw399
He, Y., Wen, Y., Tian, Z., Hart, N. T., Han, S., Hughes, S. J., & Zeng, Y. (2023b). A one-pot isothermal Cas12-based assay for the sensitive detection of microRNAs. Nature Biomedical Engineering. https://doi.org/10.1038/s41551-023-01033-1