Difference between revisions of "Part:BBa K4593006"

Line 41: Line 41:
 
</html>
 
</html>
  
The binding affinity of each truncate was calculated by subtracting the absorbance in reaction to the absorbance in the background (Table 1). The binding affinity of each truncate was then compared in Figure 2. The PA#2/8-C truncate has the strongest binding affinity, and all three truncates have been successfully designed to improve the aptamer-protein binding affinity (Figure 2.)
+
The binding affinity of each truncate was calculated by subtracting the absorbance in reaction to the absorbance in the background (Table 1). The binding affinity of each truncate was then compared in Figure 2. All three truncates have been successfully designed to improve the aptamer-protein binding affinity, and the PA#2/8-C truncate has the slightly stronger binding affinity than PA#2/8-A and PA#2/8-B (Figure 2.)
  
 
<html>
 
<html>

Revision as of 19:40, 11 October 2023


PA#2/8-A

This part is the DNA sequence of PA#2/8-A

ACCAGCTTATTCAATTAGCAACATG

Usage and Biology

The aptamer is a kind of single-strand DNA that can form the secondary structure and bind with a specific protein. In our project, the Aptamer PA#2/8 is selected to target S. aureus due to its high affinity and specificity with native and recombinant Protein A. This aptamer will be used in vitro to detect the presence of S.aureus.

Team: BNDS-China 2023

Our project aims to create a suite of effective methods for both detecting and lysing S. aureus in vivo. Also, after detecting and eliminating S.aureus in our intestine, we should confirm that we successfully killed the S.aureus, so we used this specific and high-affinity single-strand DNA aptamer targeting the transport protein Protein a specific to S.aureus. This aptamer will be used in vitro to detect the presence of S.aureus.

Design of PA#2/8-A

We employed a computational approach using the trained BERT language model in a dry lab setting. Through this screening of large amount of aptamer mutants, we discovered this aptamer as effective. We added biotin at the 3’ end to test the affinity of the aptamer

Figure 1. Secondary structure prediction of the aptamers using mfold program (a) PA#2/8-a, (b) PA#2/8-b, (c) PA#2/8-c, (d) PA#2/8-d

Examining the binding affinity of PA#2/8-A to Protein A

We utilized ELONA to verify the binding affinity of PA#2/8 and its truncates to protein A. Table 1 lists the experimental and control groups. The aptamer-only groups were used to exclude background luminescence. The full-length aptamer was used for comparison with the three truncates to determine the optimal aptamer with the highest binding affinity.

Table 1. The experimental and control groups' setting

The binding affinity of each truncate was calculated by subtracting the absorbance in reaction to the absorbance in the background (Table 1). The binding affinity of each truncate was then compared in Figure 2. All three truncates have been successfully designed to improve the aptamer-protein binding affinity, and the PA#2/8-C truncate has the slightly stronger binding affinity than PA#2/8-A and PA#2/8-B (Figure 2.)

Figure 2. The comparison of binding affinity between four aptamers


Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    COMPATIBLE WITH RFC[1000]