Difference between revisions of "Part:BBa K4665170"

Revision as of 16:02, 9 October 2023

Octahedron DNA-origami (3024bp long; 42bp edges)

Biology and Usage

DNA origami is a technique that allows for the fabrication of complex nanostructures through guided DNA folding (Majikes & Liddle, 2021). The process involves designing a long ssDNA molecule, referred to as a scaffold, which acts as a backbone for the assembly. The long strand of ssDNA will then be folded into the wanted format using short ssDNA fragments called staples. Almost any form can be achieved by altering the staple sequences.

For the purpose of our project, Sublimestone, an octahedral 3D lattice form was chosen that acted as a nucleation site for the second module of our project, calcite mineralization.

The staple sequences below were acquired using an algorithm, resulting in the desired octahedral form. The octahedral structure was chosen for its thermodynamic stability, resisting disassembly or rearrangement (Julin et al., 2020). After careful analysis, it was determined that triangular structures have the highest mechanical strength (Tandon, 2021); however, the simplicity of the shape would reduce the surface area needed for nucleation. Hence, the octahedron was chosen as the base of the lattice.

To get the ssDNA sequence a pScaf phagemid with insert for generating DNA origami was used. This phagemid was constructed by Nafisi et al., (2018). They converted pUC18 into a pagemid for custom ssDNA production by adding four components: 1) a full-length M13 origin for ssDNA initiation. 2) Kpnl and BamHl restriction sites for insert cloning. 3) M13 PS for phage particle export. 4) modified M13 origin to serve as the ssDNA synthesis terminator.

Characterisation

Conversion into ssDNA scaffold

This scaffold sequence must first be converted to a ssDNA sequence before being suitable for folding experiments. In our project, we followed the protocol created by Noteborn et al. (2022). First, the dsDNA scaffold sequence was amplified using a standard primer (5' GGGATTCATGGTGTATTGCTTCACC 3')in combination with a modified primer containing 5 phosphorothioate linkages(5'C*A*T*A*T*GACGCGCCCTGTAGC 3'), thus introducing these linkages at the first 5 basepairs at the 5' end of the desired scaffold strand (primers were ordered from IDT, * indicating phosphorothioate linkages). After PCR, the phosphorothioate-modified scaffold can be selectively digested with T7 exonuclease (obtained from New England Biolabs). This enzyme will degrade the strand lacking phosphorothioate linkages from the 5' to the 3' end, while the phosphorothiate-modified strand remains protected against T7 exonuclease digestion. The final product will be the scaffold sequence as ssDNA.

[insert a good gel image]

Folding Experiments

The folding of the ssDNA scaffold into our desired octahedron was tested in varying conditions according to . Three different parameters were tested.

Sequence and Features

References

Julin, S., Keller, A., & Linko, V. (2022). Dynamics of DNA Origami Lattices. Bioconjugate Chemistry, 34(1), 18-29. https://doi.org/10.1021/acs.bioconichem.2c00

Majikes, J.M. & Liddle, J.A. (January 8, 2021). DNA Origami Design: A How-To Tutorial. Journal of Research of the National Institute of Standards and Technology, 126:126001. https://doi.org/10.6028/jres.126.001

Nafisi, P. M., Aksel, T., Douglas, S. M. (2018) Construction of a novel phagemid to produce custom DNA origami scaffolds, Synthetic Biology, Volume 3, Issue 1, https://doi.org/10.1093/synbio/ysy015

Noteborn, W. E. M., Abendstein, L., & Sharp, T. H. (2020). One-Pot synthesis of Defined-Length SSDNA for multiscaffold DNA origami. Bioconjugate Chemistry, 32(1), 94–98. https://doi.org/10.1021/acs.bioconjchem.0c00644

Tandon, S. et al. (August 2021). Experimental investigation on tensile properties of the polymer and composite specimens printed in a Triangular pattern. Journal of manufacturing Process, 68A: 706-715. https://doi.org/10.1016/j.jmapro.2021.05.074