Difference between revisions of "Part:BBa K4593005"

Line 9: Line 9:
 
===Usage and Biology===
 
===Usage and Biology===
  
After detecting and eliminating S.aureus in our intestine, we should confirm that we successfully killed the S.aureus, so we used this specific and high-affinity single-strand DNA aptamer targeting the transport protein Protein a specific to S.aureus. This aptamer will be used in vitro to detect the presence of S.aureus.
+
The aptamer is a kind of single-strand DNA that can form the secondary structure and bind with a specific protein. In our project, the Aptamer PA#2/8 is selected to target S. aureus due to its high affinity and specificity with native and recombinant Protein A. This aptamer will be used in vitro to detect the presence of S.aureus.
  
 
==Team: BNDS-China 2023==
 
==Team: BNDS-China 2023==

Revision as of 15:17, 9 October 2023


PA#2/8

This part is the DNA sequence of PA#2/8

ATACCAGCTTATTCAATTAGCAACATGAGGGGGATAGAGGGGGTGGGTTCTCTCGGCT

Usage and Biology

The aptamer is a kind of single-strand DNA that can form the secondary structure and bind with a specific protein. In our project, the Aptamer PA#2/8 is selected to target S. aureus due to its high affinity and specificity with native and recombinant Protein A. This aptamer will be used in vitro to detect the presence of S.aureus.

Team: BNDS-China 2023

Our project aims to create a suite of effective methods for both detecting and lysing S. aureus in vivo. Also, after detecting and eliminating S.aureus in our intestine, we should confirm that we successfully killed the S.aureus, so we used this specific and high-affinity single-strand DNA aptamer targeting the transport protein Protein a specific to S.aureus. This aptamer will be used in vitro to detect the presence of S.aureus.

Design of PA#2/8

In 2016, Regina Stoltenburg and her team discovered PA#2/8 is an aptamer binding the S.aureus protein A. We added biotin at the 3’ end to test the affinity of the aptamer



Figure 1. The simulated 2D structure of PA#2/8

Verification of the interaction between PA#2/8 and Protein A

Verification through EMSA
Verification through ELONA

We utilized ELONA to verify the binding affinity of PA#2/8 to protein A. There were three groups setted: group one with both aptamer and protein A, group two with a random biotinylated library and protein A, and group three with only protein A as a control.



Figure 3. A qualitative test for the binding affinity of Protein A aptamer PA#2/8 traditional ELONA.


As can be observed in the result, showed absorbance of the group that contains PA#2/8 and protein A roughly 1000 L/(g·cm), greater than the absorbance of the group containing single protein A, proving that our aptamer PA#2/8 does have some degree of affinity for the protein A. (Figure 3.)


Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    COMPATIBLE WITH RFC[1000]