Difference between revisions of "Part:BBa K4814007"
Line 1: | Line 1: | ||
− | |||
− | |||
FRET is using fluorescent proteins as probes to detect the interaction of targeted proteins. The distance-dependent process transfers energy from an excited molecular fluorophore (the donor) to another fluorophore (the acceptor) through intermolecular long-range dipole–dipole coupling once the desired proteins bind (Sekar, R. B. and Periasamy, A., 2003). The critical Förster radius (typically 3-6 nm) at angstrom distances (10–100 Å) can be calculated to increase the accuracy and ensure precise energy transfer. (Alan Mulllan, n.d.) By using FRET, we can therefore observe the interaction of two proteins by measuring the lifetime of the fluorescent proteins attached to them. | FRET is using fluorescent proteins as probes to detect the interaction of targeted proteins. The distance-dependent process transfers energy from an excited molecular fluorophore (the donor) to another fluorophore (the acceptor) through intermolecular long-range dipole–dipole coupling once the desired proteins bind (Sekar, R. B. and Periasamy, A., 2003). The critical Förster radius (typically 3-6 nm) at angstrom distances (10–100 Å) can be calculated to increase the accuracy and ensure precise energy transfer. (Alan Mulllan, n.d.) By using FRET, we can therefore observe the interaction of two proteins by measuring the lifetime of the fluorescent proteins attached to them. | ||
Line 10: | Line 8: | ||
Alan Mulllan. (n.d.). Advanced microscopy applications – an overview of FRET. OXFORD instruments. https://andor.oxinst.com/learning/view/article/fret | Alan Mulllan. (n.d.). Advanced microscopy applications – an overview of FRET. OXFORD instruments. https://andor.oxinst.com/learning/view/article/fret | ||
+ | |||
+ | *caagtttgtacaaaaaagcaggctgccacc contains Kozak (gccacc) |
Revision as of 14:01, 28 September 2023
FRET is using fluorescent proteins as probes to detect the interaction of targeted proteins. The distance-dependent process transfers energy from an excited molecular fluorophore (the donor) to another fluorophore (the acceptor) through intermolecular long-range dipole–dipole coupling once the desired proteins bind (Sekar, R. B. and Periasamy, A., 2003). The critical Förster radius (typically 3-6 nm) at angstrom distances (10–100 Å) can be calculated to increase the accuracy and ensure precise energy transfer. (Alan Mulllan, n.d.) By using FRET, we can therefore observe the interaction of two proteins by measuring the lifetime of the fluorescent proteins attached to them.
As the aim of this design is to detect DNA damages in mammalian cells, we have used CMV promoter and the Lentivirus vector. Please refer to BBa_K4814004 and BBa_K4814005 (ATRIP and RPA1) for detailed explanation of the two proteins involved in the DNA damage checkpoint process.
The mCherry is derived from https://www.snapgene.com/plasmids/fluorescent_protein_genes_and_plasmids/mCherry (same as BBa_K4814011), a mammalian codon optimized mCherry.
Sekar, R. B., & Periasamy, A. (2003). Fluorescence resonance energy transfer (FRET) microscopy imaging of live cell protein localizations. The Journal of cell biology, 160(5), 629–633. https://doi.org/10.1083/jcb.200210140
Alan Mulllan. (n.d.). Advanced microscopy applications – an overview of FRET. OXFORD instruments. https://andor.oxinst.com/learning/view/article/fret
- caagtttgtacaaaaaagcaggctgccacc contains Kozak (gccacc)