Difference between revisions of "Part:BBa K4497030"
Line 3: | Line 3: | ||
<partinfo>BBa_K4497030 short</partinfo> | <partinfo>BBa_K4497030 short</partinfo> | ||
− | |||
A tetracyclin-inducable Transactivator (tTA) inducable miRFP680 reporter. | A tetracyclin-inducable Transactivator (tTA) inducable miRFP680 reporter. | ||
Revision as of 16:41, 13 October 2022
tTA Induceable miRFP Reporter
A tetracyclin-inducable Transactivator (tTA) inducable miRFP680 reporter.
Design & Cloning
Design
This part consists of the bidirectional Promoter Pbi-1 (Part:BBa_K4497027), that is induced by the Transcription Factor tetracycline-inducable Transactivator (tTA). The promoter is made of Tetracycline repeat elements (TRE) with a minimal CMV promoter on both sides. The promoter induces expression of the downstream miRFP (Part:BBa_K4497029), allowing for an miRFP signal readout on tTA induction of the promoter.
Cloning
We digested the plasmid pBI-MCS containing our original EYFP reporter (Part:Bba_K076004) using NotI and HindIII. We created the miRFP680 gene insert using PCR on the plasmid dCas9-zim3-P2A-miRFP680 kindly provided to us by Carolin Klose. The PCR product was purified before assembling it using Gibson Assembly and transformation in ‘’E.coli’’. The PCR primers were designed to overlap with 18bp to the digested pBI-MCS backbone:
- Primer F: TCTAGAACTAGGTCGACAGCGGCCGCTTACTCTTCCATCACGCCG
- Primer R: GCCCGGAATTCCTGCAGCAAGCTTGCCACCATGGCGGAAGGCTCCGTCGCC
Results
For testing our MESA system functionality we initially used an EYFP reporter (Part:Bba_K076004). As we wanted to measure several different fluorescence proteins to test and characterize our system, we ran into problems of signal separation:
- Reporter: EYFP (Ex513/Em527)
- Loop Ligand: 2xmCherry (Ex587/Em610), 2xmEGFP(Ex488/Em507)
- Transcription Factor: BFP (Ex381/Em445)
To alleviate this problem, we switched the reporter to miRFP680 (Ex661/Em680). The changed reporter worked as hoped (Fig. 1). Using the engineered miRFP reporter system, the overlapping FITC signal of EYFP and meGFP is eliminated (Fig. 1 A, B and C). Instead, reporter activity can now be determined through APC signal intensity (Fig. 1 D). We incorporated it into all our measurements for better comparison of our different MESA system setups (See Our Results ).
Figure 1. Flow Cytometry Histograms comparing the usage of EYFP and miRFP in our loop system. (A): Gating for FITC positive cells expressing either the miRFP or EYFP reporter. Both cell samples were also transfected with the heterodimeric MESA system G1TA & M1TEV. 500 ng/mL GFP-mCherry were added to the samples. (B) Gated FITC Histogram of the EYFP reporter sample. It is not possible to differentiate the GFP-mCherry receptor binding from the induced reporter activation. (C) Gated FITC Histogram of the miRFP reporter sample. GFP binding is visible by the signal shift of the right wing of the curve. (D) Gated APC-A Histogram of the miRFP reporter sample. The reporter signal is visible in the APC-A channel separated from the FITC signal.
Sequence and Features
- 10INCOMPATIBLE WITH RFC[10]Illegal EcoRI site found at 465
Illegal XbaI site found at 484
Illegal SpeI site found at 490
Illegal PstI site found at 471
Illegal PstI site found at 919 - 12INCOMPATIBLE WITH RFC[12]Illegal EcoRI site found at 465
Illegal SpeI site found at 490
Illegal PstI site found at 471
Illegal PstI site found at 919
Illegal NotI site found at 476 - 21INCOMPATIBLE WITH RFC[21]Illegal EcoRI site found at 465
Illegal XhoI site found at 841
Illegal XhoI site found at 847 - 23INCOMPATIBLE WITH RFC[23]Illegal EcoRI site found at 465
Illegal XbaI site found at 484
Illegal SpeI site found at 490
Illegal PstI site found at 471
Illegal PstI site found at 919 - 25INCOMPATIBLE WITH RFC[25]Illegal EcoRI site found at 465
Illegal XbaI site found at 484
Illegal SpeI site found at 490
Illegal PstI site found at 471
Illegal PstI site found at 919
Illegal NgoMIV site found at 622
Illegal NgoMIV site found at 1104 - 1000COMPATIBLE WITH RFC[1000]
References
[1]