Difference between revisions of "Part:BBa K4169029:Design"
m (→References) |
m (→Source) |
||
Line 23: | Line 23: | ||
And tmd gene is originally in Mesorhizobium sp. ORS 3359. | And tmd gene is originally in Mesorhizobium sp. ORS 3359. | ||
− | We mutated amino acid 344 form Val to Cys | + | We mutated amino acid 344 form Val to Cys. |
===References=== | ===References=== | ||
Loechel C, Basran A, Basran J, et al. Using trimethylamine dehydrogenase in an enzyme linked amperometric electrode Part 1. Wild-type enzyme redox mediation[J]. Analyst, 2003, 128(2): 166-172. | Loechel C, Basran A, Basran J, et al. Using trimethylamine dehydrogenase in an enzyme linked amperometric electrode Part 1. Wild-type enzyme redox mediation[J]. Analyst, 2003, 128(2): 166-172. |
Revision as of 12:49, 12 October 2022
Mutated TMADH
- 10INCOMPATIBLE WITH RFC[10]Illegal EcoRI site found at 388
Illegal PstI site found at 183
Illegal PstI site found at 1782 - 12INCOMPATIBLE WITH RFC[12]Illegal EcoRI site found at 388
Illegal PstI site found at 183
Illegal PstI site found at 1782 - 21INCOMPATIBLE WITH RFC[21]Illegal EcoRI site found at 388
Illegal XhoI site found at 1717 - 23INCOMPATIBLE WITH RFC[23]Illegal EcoRI site found at 388
Illegal PstI site found at 183
Illegal PstI site found at 1782 - 25INCOMPATIBLE WITH RFC[25]Illegal EcoRI site found at 388
Illegal PstI site found at 183
Illegal PstI site found at 1782
Illegal AgeI site found at 879 - 1000COMPATIBLE WITH RFC[1000]
Design Notes
GenScript synthesised tmd plasmids and performed codon optimization. We added His tag on the end of tmd sequence. Then optimized trimethylamine dehydrogenase, mutated amino acid 344 form Val to Cys.The primers we designed for mutation are showned below:
V344C-F: GACGACATCCGTTGTTGTATCGGCTG
V344C-R: CAGCCGATACAACAACGGATGTCGTC
Source
The original gene sequence of tmd is from The European Nucleotide Archive (ENA). Coding: CDX46666.1.
The link is here: https://www.ebi.ac.uk/ena/browser/view/CDX46666
And tmd gene is originally in Mesorhizobium sp. ORS 3359.
We mutated amino acid 344 form Val to Cys.
References
Loechel C, Basran A, Basran J, et al. Using trimethylamine dehydrogenase in an enzyme linked amperometric electrode Part 1. Wild-type enzyme redox mediation[J]. Analyst, 2003, 128(2): 166-172.