Difference between revisions of "Part:BBa K4417001"
| Line 5: | Line 5: | ||
<h1>Description</h1> | <h1>Description</h1> | ||
| − | This primer is designed for mutating the | + | This primer is designed for mutating the ''Bsa''I site 1 in pCT5-bac 2.0. This part is a forward primer with a mutation nucleotide, changing c to g. |
[[File:Zjy11.png|350px|thumb|center|'''Figure 1:''' pCT5-bac 2.0 with primers for site directed mutagenesis at position 647.]] | [[File:Zjy11.png|350px|thumb|center|'''Figure 1:''' pCT5-bac 2.0 with primers for site directed mutagenesis at position 647.]] | ||
| Line 18: | Line 18: | ||
* GC content: 62% | * GC content: 62% | ||
| − | [[File:Zjy12.png| | + | [[File:Zjy12.png|700px|thumb|center|'''Figure 2:''' Binding site of SDM1_Fw.]] |
<h1>Method</h1> | <h1>Method</h1> | ||
| Line 28: | Line 28: | ||
This primer will remove one BsaI site, leaving another two BsaI sites. The KLD product was transformed into DH5-α, and the plasmid was checked using a diagnostic digest. From Figure 3, the expected band size can be identified in lanes 2, 7, 11, and 15. | This primer will remove one BsaI site, leaving another two BsaI sites. The KLD product was transformed into DH5-α, and the plasmid was checked using a diagnostic digest. From Figure 3, the expected band size can be identified in lanes 2, 7, 11, and 15. | ||
| − | [[File:Zjy13.png| | + | [[File:Zjy13.png|700px|thumb|center|'''Figure 3:''' Comparative gel for pCT5c site directed mutagenesis; 1: HyperLadder<sup>TM</sup> 1kb, 2: pCT5-bac 2.0 uncut, 3: SDM1 uncut, 4: SDM1,3 uncut, 5: pCT5c uncut, 6: pCT5c cut with BsaI (3481bp, 2344bp, 2052bp), 7: SDM1 cut with BsaI (4396bp, 3481bp), 8: SDM1,3 cut with BsaI (7877bp), 9: pCT5c cut with BsaI, 10: pCT5-bac 2.0 cut with BamHI/SacI (6851bp, 1026bp), 11: SDM1 cut with BamHI/SacI (6851bp, 1026bp), 12: SDM1,3 cut with BamHI/SacI (6851bp, 1026bp), 13: pCT5c cut with BamHI/SacI (6851bp, 1026bp), 14: pCT5-bac 2.0 cut with BamHI/BsaI (3481bp, 2087bp, 2052bp, 257bp), 15: SDM1 cut with BamHI/BsaI (3481bp, 2309bp, 2087bp), 16: SDM1,3 cut with BamHI/BsaI (5790bp, 2087bp), 17: pCT5c cut with BamHI/BsaI, 18: HyperLadder<sup>TM</sup> 1kb.]] |
Revision as of 09:21, 12 October 2022
SDM1 Forward Primer for pCT5c Mutation
Description
This primer is designed for mutating the BsaI site 1 in pCT5-bac 2.0. This part is a forward primer with a mutation nucleotide, changing c to g.
Usage and Biology
- This part is used in site directed mutagenesis of pCT5c (Part: BBa_K4417000).
- Sequence: tgccctgggtttccattgcgc
- Length: 21-mer
- Tm: 61℃
- GC content: 62%
Method
This part is used with BBa_K4417000 and BBa_K4417002. A detailed protocol is described in BBa_K4417000.
Characterization
This primer will remove one BsaI site, leaving another two BsaI sites. The KLD product was transformed into DH5-α, and the plasmid was checked using a diagnostic digest. From Figure 3, the expected band size can be identified in lanes 2, 7, 11, and 15.
Figure 3: Comparative gel for pCT5c site directed mutagenesis; 1: HyperLadderTM 1kb, 2: pCT5-bac 2.0 uncut, 3: SDM1 uncut, 4: SDM1,3 uncut, 5: pCT5c uncut, 6: pCT5c cut with BsaI (3481bp, 2344bp, 2052bp), 7: SDM1 cut with BsaI (4396bp, 3481bp), 8: SDM1,3 cut with BsaI (7877bp), 9: pCT5c cut with BsaI, 10: pCT5-bac 2.0 cut with BamHI/SacI (6851bp, 1026bp), 11: SDM1 cut with BamHI/SacI (6851bp, 1026bp), 12: SDM1,3 cut with BamHI/SacI (6851bp, 1026bp), 13: pCT5c cut with BamHI/SacI (6851bp, 1026bp), 14: pCT5-bac 2.0 cut with BamHI/BsaI (3481bp, 2087bp, 2052bp, 257bp), 15: SDM1 cut with BamHI/BsaI (3481bp, 2309bp, 2087bp), 16: SDM1,3 cut with BamHI/BsaI (5790bp, 2087bp), 17: pCT5c cut with BamHI/BsaI, 18: HyperLadderTM 1kb.
Sequence and Features
Assembly Compatibility:
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21COMPATIBLE WITH RFC[21]
- 23COMPATIBLE WITH RFC[23]
- 25COMPATIBLE WITH RFC[25]
- 1000COMPATIBLE WITH RFC[1000]