Difference between revisions of "Part:BBa K4441005"

Revision as of 05:36, 12 October 2022

BRAF V600E B3

Sequence used in wetlab experiments: TCTGACTGAAAGCTGTATGG is taken from [1]

Usage and Biology

This is the sequence for the outer backward primer. The outer backward primer consists of a B3 region which is complementary to the B3c region of the template sequence [2]. The outer primer B3 hybridizes to B3c region of the target DNA and extends, displacing the BIP linked complementary strand and resulting in the formation of a dumbbell shaped DNA [2]. This B3 primer is part of the primer set that detects the BRAF V600E: TTACTTACACGCCAAGTCAATCATCCACAGAGACCTCAAGAGTAATAATATATTTCTTCATGAAGACCTCACAGTAAAAATAGGTGATTTTGGTCTAGCTACAGAGAAATCTCGATGGA GTGGGTCCCATCAGTTTGAACAGTTGTCTGGATCCATTTTGTGGATGGCACCAGAAGTCATCAGAATGCAAGATAAAAATCCATACAGCTTTCAGTCAGATGTATATGCATTTGGAATT GTTCTGTATGAATTGATGACTGGACAGTTACCTTATTCAAACATCAACAACAGGGACCAG

Dilutions

Storage Primer Concentration: 100 μM

10X Concentration (Stock): 16 μM

Volume of 10X primer mix: 10 μL

1X Concentration (Final): 1.6 μM

Volume of storage primer needed: 0.2 μL

Mixed with F3, FIP, BIP, LF and LB for a total of 4.4 μL -- Final primer mix 1 μL of final primer mix is used in the LAMP reaction mix. For more information, visit https://2022.igem.org/Team:Washington

Alternative Sequence

As this set of primer failed to produce a positive result, we used NEB LAMP Primer Design Tool (https://lamp.neb.com/#!/) to generate an alternative set of primers. Unfortunately, due to time and budgetary constraints, these primers have not been ordered and experimented with yet.

Sequence: TCTGACTGAAAGCTGTATGG

5′ pos: 200

3′ pos: 21

len: 20

Tm: 56.40

5′ dG: -4.76

3′ dG: -4.23

% GC: 45

Citations

1. Papadakis, G., Pantazis, A. K., Fikas, N., Chatziioannidou, S., Tsiakalou, V., Michaelidou, K., ... & Gizeli, E. (2022). Portable real-time colorimetric LAMP-device for rapid quantitative detection of nucleic acids in crude samples. Scientific reports, 12(1), 1-15.

2. Loop mediated isothermal amplification - technote. (n.d.). Retrieved October 11, 2022, from http://www.premierbiosoft.com/tech_notes/Loop-Mediated-Isothermal-Amplification.html

Sequence and Features