Difference between revisions of "Part:BBa K4441004"

Revision as of 04:59, 12 October 2022

BRAF V600E F3

Sequence used in wetlab experiments: GGAAAATGAGATCTACTG is taken from [1]

Usage and Biology

This is the sequence for the outer forward primer. The outer forward primer complementary to the F3c region of the template sequence [2]. Outer primer F3 hybridizes to the F3c region of the target DNA and extends, displacing the FIP linked complementary strand[2]. This displaced strand forms a loop at the 5' end primer is shorter in length and lower in concentration than FIP (forward inner primer) [2]. This F3 primer is part of the primer set that detects the BRAF V600E: TTACTTACACGCCAAGTCAATCATCCACAGAGACCTCAAGAGTAATAATATATTTCTTCATGAAGACCTCACAGTAAAAATAGGTGATTTTGGTCTAGCTACAGAGAAATCTCGATGGA GTGGGTCCCATCAGTTTGAACAGTTGTCTGGATCCATTTTGTGGATGGCACCAGAAGTCATCAGAATGCAAGATAAAAATCCATACAGCTTTCAGTCAGATGTATATGCATTTGGAATT GTTCTGTATGAATTGATGACTGGACAGTTACCTTATTCAAACATCAACAACAGGGACCAG

Dilutions

Storage Primer Concentration: 100 μM

10X Concentration (Stock): 16 μM

Volume of 10X primer mix: 10 μL

1X Concentration (Final):1.6 μM

Volume of storage primer needed: 0.2 μL

Mixed with B3, FIP, BIP, LF and LB for a total of 4.4 μL -- Final primer mix 1 μL of final primer mix is used in the LAMP reaction mix. For more information, visit https://2022.igem.org/Team:Washington

Alternative Sequence

As this set of primer failed to produce a positive result, we used NEB LAMP Primer Design Tool (https://lamp.neb.com/#!/) to generate an alternative set of primers. Unfortunately, due to time and budgetary constraints, these primers have not been ordered and experimented with yet.

Sequence: TACACGCCAAGTCAATCA 5′ pos: 6 3′ pos: 23 len: 18 Tm: 55.35 5′ dG:-5.07 3′ dG: -4.07 % GC: 44

Citations

1. Papadakis, G., Pantazis, A. K., Fikas, N., Chatziioannidou, S., Tsiakalou, V., Michaelidou, K., ... & Gizeli, E. (2022). Portable real-time colorimetric LAMP-device for rapid quantitative detection of nucleic acids in crude samples. Scientific reports, 12(1), 1-15.

2. Loop mediated isothermal amplification - technote. (n.d.). Retrieved October 11, 2022, from http://www.premierbiosoft.com/tech_notes/Loop-Mediated-Isothermal-Amplification.html Sequence and Features